Regulog KojR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Kojibiose utilization |
| Effector: | Kojibiose |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By effector - Kojibiose
- By pathway - Kojibiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 6 | 1 |
| Chloroflexus sp. Y-400-fl | 6 | 1 |
| Roseiflexus castenholzii DSM 13941 | ||
| Roseiflexus sp. RS-1 | ||
| Herpetosiphon aurantiacus ATCC 23779 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| kojR |
*
Chloroflexus aggregans DSM 9485 Site: position = -90 score = 6.52755 sequence = TTAAGCGAACGTTCGCTTTT Site: position = -36 score = 6.48364 sequence = TAAGGCGAACGTTCGCCCTA Gene: Cagg_2268: Predicted transcriptional regulator for kojibiose utilization, LacI family |
*
Chloroflexus sp. Y-400-fl Site: position = -30 score = 6.53787 sequence = AAAAGCGAACGTTCGCCTAG Site: position = -84 score = 6.4795 sequence = CCAGGCGAACGTTCGCTTTT Gene: Chy400_2182: Predicted transcriptional regulator for kojibiose utilization, LacI family |
|
|
|
Predicted transcriptional regulator for kojibiose utilization, LacI family |
| kojE |
*
Chloroflexus aggregans DSM 9485 Site: position = 170 score = 4.83704 sequence = AAAAGTGACCGTCCGCTTGT Gene: Cagg_2267: Kojibiose ABC transporter, substrate-binding protein |
Gene: Chy400_2181: Kojibiose ABC transporter, substrate-binding protein |
|
|
|
Kojibiose ABC transporter, substrate-binding protein |
| kojF |
Gene: Cagg_2266: Kojibiose ABC transporter, permease protein 1 |
Gene: Chy400_2180: Kojibiose ABC transporter, permease protein 1 |
|
|
|
Kojibiose ABC transporter, permease protein 1 |
| kojG |
Gene: Cagg_2265: Kojibiose ABC transporter, permease protein 2 |
Gene: Chy400_2179: Kojibiose ABC transporter, permease protein 2 |
|
|
|
Kojibiose ABC transporter, permease protein 2 |
| kojP |
Gene: Cagg_2264: Kojibiose phosphorylase (EC 2.4.1.230) |
Gene: Chy400_2178: Kojibiose phosphorylase (EC 2.4.1.230) |
|
|
|
Kojibiose phosphorylase (EC 2.4.1.230) |
| pgmB |
Gene: Cagg_2263: Beta-phosphoglucomutase (EC 5.4.2.6) |
Gene: Chy400_2177: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
|
|
Beta-phosphoglucomutase (EC 5.4.2.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |