Regulon of KojR in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_2182
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.5 Sequence: CCAGGCGAACGTTCGCTTTT Position: -30 Score: 6.5 Sequence: AAAAGCGAACGTTCGCCTAG Locus tag: Chy400_2182 Name: kojR Funciton: Predicted transcriptional regulator for kojibiose utilization, LacI family Locus tag: Chy400_2181 Name: kojE Funciton: Kojibiose ABC transporter, substrate-binding protein Locus tag: Chy400_2180 Name: kojF Funciton: Kojibiose ABC transporter, permease protein 1 Locus tag: Chy400_2179 Name: kojG Funciton: Kojibiose ABC transporter, permease protein 2 Locus tag: Chy400_2178 Name: kojP Funciton: Kojibiose phosphorylase (EC 2.4.1.230) Locus tag: Chy400_2177 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
	Chy400_2182	kojR	Predicted transcriptional regulator for kojibiose utilization, LacI family
	Chy400_2181	kojE	Kojibiose ABC transporter, substrate-binding protein
	Chy400_2180	kojF	Kojibiose ABC transporter, permease protein 1
	Chy400_2179	kojG	Kojibiose ABC transporter, permease protein 2
	Chy400_2178	kojP	Kojibiose phosphorylase (EC 2.4.1.230)
	Chy400_2177	pgmB	Beta-phosphoglucomutase (EC 5.4.2.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD