Profile of regulator KojR in Chloroflexia

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Chloroflexia

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Chloroflexus aggregans DSM 9485
	Cagg_2268	kojR	-90	6.5	TTAAGCGAACGTTCGCTTTT
	Cagg_2268	kojR	-36	6.5	TAAGGCGAACGTTCGCCCTA
	Cagg_2267	kojE	170	4.8	AAAAGTGACCGTCCGCTTGT
Chloroflexus sp. Y-400-fl
	Chy400_2182	kojR	-30	6.5	AAAAGCGAACGTTCGCCTAG
	Chy400_2182	kojR	-84	6.5	CCAGGCGAACGTTCGCTTTT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD