Regulon of KojR in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_2268
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.5 Sequence: TTAAGCGAACGTTCGCTTTT Position: -36 Score: 6.5 Sequence: TAAGGCGAACGTTCGCCCTA Position: 170 Score: 4.8 Sequence: AAAAGTGACCGTCCGCTTGT Locus tag: Cagg_2268 Name: kojR Funciton: Predicted transcriptional regulator for kojibiose utilization, LacI family Locus tag: Cagg_2267 Name: kojE Funciton: Kojibiose ABC transporter, substrate-binding protein Locus tag: Cagg_2266 Name: kojF Funciton: Kojibiose ABC transporter, permease protein 1 Locus tag: Cagg_2265 Name: kojG Funciton: Kojibiose ABC transporter, permease protein 2 Locus tag: Cagg_2264 Name: kojP Funciton: Kojibiose phosphorylase (EC 2.4.1.230) Locus tag: Cagg_2263 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
	Cagg_2268	kojR	Predicted transcriptional regulator for kojibiose utilization, LacI family
	Cagg_2267	kojE	Kojibiose ABC transporter, substrate-binding protein
	Cagg_2266	kojF	Kojibiose ABC transporter, permease protein 1
	Cagg_2265	kojG	Kojibiose ABC transporter, permease protein 2
	Cagg_2264	kojP	Kojibiose phosphorylase (EC 2.4.1.230)
	Cagg_2263	pgmB	Beta-phosphoglucomutase (EC 5.4.2.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD