Regulog RhaR - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Nocardiaceae
- By TF family - LacI
- By effector - Rhamnose
- By pathway - Rhamnose utilization
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | 7 | 1 |
| Rhodococcus erythropolis PR4 | ||
| Rhodococcus opacus B4 | ||
| Rhodococcus sp. RHA1 | 10 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| rhaG |
|
|
|
*
Rhodococcus sp. RHA1 Site: position = -218 score = 5.77936 sequence = CTCTTGAATCGCTTCAGTCC Site: position = -30 score = 6.05618 sequence = GAAATGAACCGTTTCAATCG Gene: RHA1_ro04085: L-rhamnose ABC transporter, duplicated ATP-binding component |
L-rhamnose ABC transporter, duplicated ATP-binding component |
| rhaJ |
|
|
|
Gene: RHA1_ro04086: L-rhamnose ABC transporter, permease component 2 |
L-rhamnose ABC transporter, permease component 2 |
| rhaH |
|
|
|
Gene: RHA1_ro04087: L-rhamnose ABC transporter, permease component 1 |
L-rhamnose ABC transporter, permease component 1 |
| rhaF |
|
|
|
Gene: RHA1_ro04088: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein |
L-rhamnose ABC transporter, periplasmic rhamnose-binding protein |
| rhaM |
*
Nocardia farcinica IFM 10152 Site: position = -34 score = 5.65885 sequence = GTATTGAAACGTTTCAACGA Gene: nfa32910: L-rhamnose mutarotase |
|
|
Gene: RHA1_ro04089: L-rhamnose mutarotase |
L-rhamnose mutarotase |
| rhaI |
Gene: nfa32930: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
|
|
Gene: RHA1_ro04090: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
| RHA1_ro04091 |
|
|
|
Gene: RHA1_ro04091: putative L-arabinose isomerase |
putative L-arabinose isomerase |
| rhaEW |
Gene: nfa32940: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
|
|
Gene: RHA1_ro04092: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
| rhaB |
Gene: nfa32950: Rhamnulokinase (EC 2.7.1.5) |
|
|
Gene: RHA1_ro04093: Rhamnulokinase (EC 2.7.1.5) |
Rhamnulokinase (EC 2.7.1.5) |
| rhaY |
Gene: nfa32920: Predicted L-rhamnose permease RhaY |
|
|
|
Predicted L-rhamnose permease RhaY |
| lldD |
Gene: nfa32960: L-lactate dehydrogenase (EC 1.1.2.3) |
|
|
Gene: RHA1_ro02988: L-lactate dehydrogenase (EC 1.1.2.3) |
L-lactate dehydrogenase (EC 1.1.2.3) |
| rhaR |
Gene: nfa32970: Transcriptional regulator of rhamnose utilization, LacI family |
|
|
*
Rhodococcus sp. RHA1 Site: position = -282 score = 6.05618 sequence = CGATTGAAACGGTTCATTTC Site: position = -94 score = 5.77936 sequence = GGACTGAAGCGATTCAAGAG Gene: RHA1_ro04084: Transcriptional regulator of rhamnose utilization, LacI family |
Transcriptional regulator of rhamnose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |