Regulon of RhaR in Rhodococcus sp. RHA1

Properties
Regulator type:	Transcription factor
TF locus tag:	RHA1_ro04084
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Regulog:	RhaR - Nocardiaceae
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By TF family - LacI
By effector - Rhamnose
By pathway - Rhamnose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -282 Score: 6.1 Sequence: CGATTGAAACGGTTCATTTC Position: -94 Score: 5.8 Sequence: GGACTGAAGCGATTCAAGAG Locus tag: RHA1_ro04084 Name: rhaR Funciton: Transcriptional regulator of rhamnose utilization, LacI family
	RHA1_ro04084	rhaR	Transcriptional regulator of rhamnose utilization, LacI family
Position: -218 Score: 5.8 Sequence: CTCTTGAATCGCTTCAGTCC Position: -30 Score: 6.1 Sequence: GAAATGAACCGTTTCAATCG Locus tag: RHA1_ro04085 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: RHA1_ro04086 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: RHA1_ro04087 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: RHA1_ro04088 Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein Locus tag: RHA1_ro04089 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: RHA1_ro04090 Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) Locus tag: RHA1_ro04091 Name: null Funciton: putative L-arabinose isomerase Locus tag: RHA1_ro04092 Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) Locus tag: RHA1_ro04093 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
	RHA1_ro04085	rhaG	L-rhamnose ABC transporter, duplicated ATP-binding component
	RHA1_ro04086	rhaJ	L-rhamnose ABC transporter, permease component 2
	RHA1_ro04087	rhaH	L-rhamnose ABC transporter, permease component 1
	RHA1_ro04088	rhaF	L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
	RHA1_ro04089	rhaM	L-rhamnose mutarotase
	RHA1_ro04090	rhaI	Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)
	RHA1_ro04091		putative L-arabinose isomerase
	RHA1_ro04092	rhaEW	Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)
	RHA1_ro04093	rhaB	Rhamnulokinase (EC 2.7.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD