Orthologous regulated operons containing rhaM gene

Properties
Regulog:	RhaR - Nocardiaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -34 Score: 5.65885 Sequence: GTATTGAAACGTTTCAACGA Locus tag: nfa32910 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: nfa32920 Name: rhaY Funciton: Predicted L-rhamnose permease RhaY Locus tag: nfa32930 Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) Locus tag: nfa32940 Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) Locus tag: nfa32950 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5) Locus tag: nfa32960 Name: lldD Funciton: L-lactate dehydrogenase (EC 1.1.2.3) Locus tag: nfa32970 Name: rhaR Funciton: Transcriptional regulator of rhamnose utilization, LacI family
rhaM-rhaY-rhaI-rhaEW-rhaB-lldD-rhaR	-34	5.7	GTATTGAAACGTTTCAACGA	nfa32910
Rhodococcus sp. RHA1
Position: -218 Score: 5.77936 Sequence: CTCTTGAATCGCTTCAGTCC Position: -30 Score: 6.05618 Sequence: GAAATGAACCGTTTCAATCG Locus tag: RHA1_ro04085 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: RHA1_ro04086 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: RHA1_ro04087 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: RHA1_ro04088 Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein Locus tag: RHA1_ro04089 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: RHA1_ro04090 Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) Locus tag: RHA1_ro04091 Name: null Funciton: putative L-arabinose isomerase Locus tag: RHA1_ro04092 Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) Locus tag: RHA1_ro04093 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
rhaG-rhaJ-rhaH-rhaF-rhaM-rhaI-RHA1_ro04091-rhaEW-rhaB	-218	5.8	CTCTTGAATCGCTTCAGTCC	RHA1_ro04085
	-30	6.1	GAAATGAACCGTTTCAATCG