Statistics of regulated genes

Genome	Genes	Operons
Candidatus Methanoregula boonei 6A8	8	2
Candidatus Methanosphaerula palustris E1-9c	3	2
Methanocorpusculum labreanum Z	2	2
Methanoculleus marisnigri JR1	3	2
Methanospirillum hungatei JF-1	5	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
Mboo_1603	* Candidatus Methanoregula boonei 6A8 Site: position = -167 score = 4.2996 sequence = CGCACTAAAACATTGTTAGTTAT Site: position = -43 score = 4.85118 sequence = CAGACTAACTAATGGTTAATCCT Gene: Mboo_1603: Hypothetical protein	Candidatus Methanosphaerula palustris E1-9c	Methanocorpusculum labreanum Z	Methanoculleus marisnigri JR1	Methanospirillum hungatei JF-1	Hypothetical protein
clpB	Candidatus Methanoregula boonei 6A8 Gene: Mboo_1604: ATPase AAA-2 domain protein	Candidatus Methanosphaerula palustris E1-9c	Methanocorpusculum labreanum Z	Methanoculleus marisnigri JR1	Methanospirillum hungatei JF-1 Gene: Mhun_1289: ATPase AAA-2 domain protein	ATPase AAA-2 domain protein
grpE	2 Candidatus Methanoregula boonei 6A8 Gene: Mboo_1206: Heat shock protein GrpE Gene: Mboo_1605: Heat shock protein GrpE	2 Candidatus Methanosphaerula palustris E1-9c Gene: Mpal_1614: Heat shock protein GrpE Gene: Mpal_2350: Heat shock protein GrpE	Methanocorpusculum labreanum Z Gene: Mlab_0944: Heat shock protein GrpE	Methanoculleus marisnigri JR1 Gene: Memar_1062: Heat shock protein GrpE	* Methanospirillum hungatei JF-1 Site: position = -182 score = 5.01997 sequence = TACACTAACTTCAAGTAAATACT Gene: Mhun_0129: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	2 Candidatus Methanoregula boonei 6A8 Gene: Mboo_1207: Chaperone protein DnaK Gene: Mboo_1606: Chaperone protein DnaK	2 Candidatus Methanosphaerula palustris E1-9c Gene: Mpal_1615: Chaperone protein DnaK Gene: Mpal_2349: Chaperone protein DnaK	Methanocorpusculum labreanum Z Gene: Mlab_0943: Chaperone protein DnaK	Methanoculleus marisnigri JR1 Gene: Memar_1061: Chaperone protein DnaK	Methanospirillum hungatei JF-1 Gene: Mhun_0128: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	2 Candidatus Methanoregula boonei 6A8 Gene: Mboo_1607: Chaperone protein DnaJ Gene: Mboo_1208: Chaperone protein DnaJ	2 Candidatus Methanosphaerula palustris E1-9c Gene: Mpal_1616: Chaperone protein DnaJ Gene: Mpal_2348: Chaperone protein DnaJ	Methanocorpusculum labreanum Z Gene: Mlab_0942: Chaperone protein DnaJ	Methanoculleus marisnigri JR1 Gene: Memar_1060: Chaperone protein DnaJ	Methanospirillum hungatei JF-1 Gene: Mhun_0127: Chaperone protein DnaJ	Chaperone protein DnaJ
hsp20-1	Candidatus Methanoregula boonei 6A8 Gene: Mboo_1608: Small heat shock protein 20	* Candidatus Methanosphaerula palustris E1-9c Site: position = -69 score = 5.06234 sequence = ACCACTTACTTTTGGTTAGTTCA Gene: Mpal_0298: Small heat shock protein 20	* Methanocorpusculum labreanum Z Site: position = -55 score = 5.2372 sequence = GTGACTTACTATTAGTAAATCAC Gene: Mlab_1294: Small heat shock protein 20	*3 Methanoculleus marisnigri JR1 Gene: Memar_1758: Small heat shock protein 20 Site: position = -71 score = 4.95617 sequence = GACACTACCTTAAGGTTAGCCTC Gene: Memar_1986: Small heat shock protein 20 Gene: Memar_1494: Small heat shock protein 20	Methanospirillum hungatei JF-1 Gene: Mhun_0154: Small heat shock protein 20	Small heat shock protein 20
CRON 2.
phr	* Candidatus Methanoregula boonei 6A8 Site: position = -20 score = 5.38356 sequence = AACACTAACATAAAGTAAACATG Gene: Mboo_1711: Heat shock response regulator Phr, ArsR family	* Candidatus Methanosphaerula palustris E1-9c Site: position = -21 score = 5.42191 sequence = CTCCCTAACATAAAGTAAATAAT Gene: Mpal_2059: Heat shock response regulator Phr, ArsR family	* Methanocorpusculum labreanum Z Site: position = -28 score = 4.30366 sequence = TCCCCTTACATAATGTAATCTCG Gene: Mlab_1236: Heat shock response regulator Phr, ArsR family	* Methanoculleus marisnigri JR1 Site: position = -20 score = 5.47818 sequence = ATCACTAACATTTAGTAAATATG Gene: Memar_1567: Heat shock response regulator Phr, ArsR family	* Methanospirillum hungatei JF-1 Site: position = -21 score = 5.66575 sequence = TTCACTAACATAGAGTTAGTGAT Gene: Mhun_2633: Heat shock response regulator Phr, ArsR family	Heat shock response regulator Phr, ArsR family
hsp20-2	Candidatus Methanoregula boonei 6A8 Gene: Mboo_1710: Small heat shock protein 20	Candidatus Methanosphaerula palustris E1-9c Gene: Mpal_2058: Small heat shock protein 20	Methanocorpusculum labreanum Z	Methanoculleus marisnigri JR1 Gene: Memar_1566: Small heat shock protein 20	Methanospirillum hungatei JF-1 Gene: Mhun_2634: Small heat shock protein 20	Small heat shock protein 20

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD