Regulon of Phr in Methanoculleus marisnigri JR1

Properties
Regulator type:	Transcription factor
TF locus tag:	Memar_1567
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanomicrobiales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Methanomicrobiales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5 Sequence: GACACTACCTTAAGGTTAGCCTC Locus tag: Memar_1986 Name: hsp20-1 Funciton: Small heat shock protein 20
	Memar_1986	hsp20-1	Small heat shock protein 20
Position: -20 Score: 5.5 Sequence: ATCACTAACATTTAGTAAATATG Locus tag: Memar_1567 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Memar_1566 Name: hsp20-2 Funciton: Small heat shock protein 20
	Memar_1567	phr	Heat shock response regulator Phr, ArsR family
	Memar_1566	hsp20-2	Small heat shock protein 20

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD