Regulon of Phr in Methanospirillum hungatei JF-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mhun_2633
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanomicrobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Methanomicrobiales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -182 Score: 5 Sequence: TACACTAACTTCAAGTAAATACT Locus tag: Mhun_0129 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Mhun_0128 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Mhun_0127 Name: dnaJ Funciton: Chaperone protein DnaJ
	Mhun_0129	grpE	Heat shock protein GrpE
	Mhun_0128	dnaK	Chaperone protein DnaK
	Mhun_0127	dnaJ	Chaperone protein DnaJ
Position: -21 Score: 5.7 Sequence: TTCACTAACATAGAGTTAGTGAT Locus tag: Mhun_2633 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Mhun_2634 Name: hsp20-2 Funciton: Small heat shock protein 20
	Mhun_2633	phr	Heat shock response regulator Phr, ArsR family
	Mhun_2634	hsp20-2	Small heat shock protein 20

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD