Regulon of Phr in Candidatus Methanoregula boonei 6A8

Properties
Regulator type:	Transcription factor
TF locus tag:	Mboo_1711
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanomicrobiales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Methanomicrobiales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 4.3 Sequence: CGCACTAAAACATTGTTAGTTAT Position: -43 Score: 4.9 Sequence: CAGACTAACTAATGGTTAATCCT Locus tag: Mboo_1603 Name: Mboo_1603 Funciton: Hypothetical protein Locus tag: Mboo_1604 Name: clpB Funciton: ATPase AAA-2 domain protein Locus tag: Mboo_1605 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Mboo_1606 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Mboo_1607 Name: dnaJ Funciton: Chaperone protein DnaJ Locus tag: Mboo_1608 Name: hsp20-1 Funciton: Small heat shock protein 20
	Mboo_1603	Mboo_1603	Hypothetical protein
	Mboo_1604	clpB	ATPase AAA-2 domain protein
	Mboo_1605	grpE	Heat shock protein GrpE
	Mboo_1606	dnaK	Chaperone protein DnaK
	Mboo_1607	dnaJ	Chaperone protein DnaJ
	Mboo_1608	hsp20-1	Small heat shock protein 20
Position: -20 Score: 5.4 Sequence: AACACTAACATAAAGTAAACATG Locus tag: Mboo_1711 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Mboo_1710 Name: hsp20-2 Funciton: Small heat shock protein 20
	Mboo_1711	phr	Heat shock response regulator Phr, ArsR family
	Mboo_1710	hsp20-2	Small heat shock protein 20

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD