Regulog Phr - Methanobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | |
| Phylum: | Euryarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Methanobacteriales
- By trascription factor - Phr
- By TF family - ArsR
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Methanobrevibacter ruminantium M1 | 3 | 2 |
| Methanobrevibacter smithii ATCC 35061 | 4 | 2 |
| Methanobrevibacter smithii DSM 2375 | 4 | 2 |
| Methanosphaera stadtmanae DSM 3091 | 4 | 2 |
| Methanothermobacter thermautotrophicus str. Delta H | 4 | 2 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| grpE |
*
Methanobrevibacter ruminantium M1 Site: position = -448 score = 5.43247 sequence = TAAAATTACTTTTTGTAAGAAAA Site: position = -414 score = 6.42552 sequence = TTATATAACATTTTGTTACTAAA Gene: mru_2038: Heat shock protein GrpE |
*
Methanobrevibacter smithii ATCC 35061 Site: position = -217 score = 6.20698 sequence = TTATATAACTTTTTGTTACTATA Gene: Msm_1108: Heat shock protein GrpE |
*
Methanobrevibacter smithii DSM 2375 Site: position = -217 score = 6.20698 sequence = TTATATAACTTTTTGTTACTATA Gene: METSMIALI_01035: Heat shock protein GrpE |
*
Methanosphaera stadtmanae DSM 3091 Site: position = -122 score = 6.04859 sequence = ATATATAACATTTTGTTACTAAA Site: position = -156 score = 6.25812 sequence = TTTTGTAACTAAAAGTTATTAAA Gene: Msp_1518: Heat shock protein GrpE |
*
Methanothermobacter thermautotrophicus str. Delta H Site: position = -88 score = 5.5898 sequence = TTATATAACCTTTTGTAAGTATA Gene: MTH1289: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
Gene: mru_2039: Chaperone protein DnaK |
Gene: Msm_1109: Chaperone protein DnaK |
Gene: METSMIALI_01036: Chaperone protein DnaK |
Gene: Msp_1517: Chaperone protein DnaK |
Gene: MTH1290: Chaperone protein DnaK |
Chaperone protein DnaK |
| dnaJ |
Gene: mru_2040: Chaperone protein DnaJ |
Gene: Msm_1110: Chaperone protein DnaJ |
Gene: METSMIALI_01037: Chaperone protein DnaJ |
Gene: Msp_1516: Chaperone protein DnaJ |
Gene: MTH1291: Chaperone protein DnaJ |
Chaperone protein DnaJ |
| CRON 2. | ||||||
| phr |
*
Methanobrevibacter ruminantium M1 Site: position = -149 score = 5.81278 sequence = TTTAGTAACAAAAAGTTAATATA Site: position = -238 score = 6.42552 sequence = TTTAGTAACAAAATGTTATATAA Gene: mru_2037: Heat shock response regulator Phr, ArsR family |
*
Methanobrevibacter smithii ATCC 35061 Site: position = -46 score = 6.20698 sequence = TATAGTAACAAAAAGTTATATAA Gene: Msm_1107: Heat shock response regulator Phr, ArsR family |
*
Methanobrevibacter smithii DSM 2375 Site: position = -46 score = 6.20698 sequence = TATAGTAACAAAAAGTTATATAA Gene: METSMIALI_01034: Heat shock response regulator Phr, ArsR family |
*
Methanosphaera stadtmanae DSM 3091 Site: position = -187 score = 6.04859 sequence = TTTAGTAACAAAATGTTATATAT Site: position = -153 score = 6.25812 sequence = TTTAATAACTTTTAGTTACAAAA Gene: Msp_1519: Heat shock response regulator Phr, ArsR family |
*
Methanothermobacter thermautotrophicus str. Delta H Site: position = -42 score = 5.5898 sequence = TATACTTACAAAAGGTTATATAA Gene: MTH1288: Heat shock response regulator Phr, ArsR family |
Heat shock response regulator Phr, ArsR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |