Statistics of regulated genes

Genome	Genes	Operons
Methanobrevibacter ruminantium M1	3	2
Methanobrevibacter smithii ATCC 35061	4	2
Methanobrevibacter smithii DSM 2375	4	2
Methanosphaera stadtmanae DSM 3091	4	2
Methanothermobacter thermautotrophicus str. Delta H	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
grpE	* Methanobrevibacter ruminantium M1 Site: position = -448 score = 5.43247 sequence = TAAAATTACTTTTTGTAAGAAAA Site: position = -414 score = 6.42552 sequence = TTATATAACATTTTGTTACTAAA Gene: mru_2038: Heat shock protein GrpE	* Methanobrevibacter smithii ATCC 35061 Site: position = -217 score = 6.20698 sequence = TTATATAACTTTTTGTTACTATA Gene: Msm_1108: Heat shock protein GrpE	* Methanobrevibacter smithii DSM 2375 Site: position = -217 score = 6.20698 sequence = TTATATAACTTTTTGTTACTATA Gene: METSMIALI_01035: Heat shock protein GrpE	* Methanosphaera stadtmanae DSM 3091 Site: position = -122 score = 6.04859 sequence = ATATATAACATTTTGTTACTAAA Site: position = -156 score = 6.25812 sequence = TTTTGTAACTAAAAGTTATTAAA Gene: Msp_1518: Heat shock protein GrpE	* Methanothermobacter thermautotrophicus str. Delta H Site: position = -88 score = 5.5898 sequence = TTATATAACCTTTTGTAAGTATA Gene: MTH1289: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Methanobrevibacter ruminantium M1 Gene: mru_2039: Chaperone protein DnaK	Methanobrevibacter smithii ATCC 35061 Gene: Msm_1109: Chaperone protein DnaK	Methanobrevibacter smithii DSM 2375 Gene: METSMIALI_01036: Chaperone protein DnaK	Methanosphaera stadtmanae DSM 3091 Gene: Msp_1517: Chaperone protein DnaK	Methanothermobacter thermautotrophicus str. Delta H Gene: MTH1290: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	Methanobrevibacter ruminantium M1 Gene: mru_2040: Chaperone protein DnaJ	Methanobrevibacter smithii ATCC 35061 Gene: Msm_1110: Chaperone protein DnaJ	Methanobrevibacter smithii DSM 2375 Gene: METSMIALI_01037: Chaperone protein DnaJ	Methanosphaera stadtmanae DSM 3091 Gene: Msp_1516: Chaperone protein DnaJ	Methanothermobacter thermautotrophicus str. Delta H Gene: MTH1291: Chaperone protein DnaJ	Chaperone protein DnaJ
CRON 2.
phr	* Methanobrevibacter ruminantium M1 Site: position = -149 score = 5.81278 sequence = TTTAGTAACAAAAAGTTAATATA Site: position = -238 score = 6.42552 sequence = TTTAGTAACAAAATGTTATATAA Gene: mru_2037: Heat shock response regulator Phr, ArsR family	* Methanobrevibacter smithii ATCC 35061 Site: position = -46 score = 6.20698 sequence = TATAGTAACAAAAAGTTATATAA Gene: Msm_1107: Heat shock response regulator Phr, ArsR family	* Methanobrevibacter smithii DSM 2375 Site: position = -46 score = 6.20698 sequence = TATAGTAACAAAAAGTTATATAA Gene: METSMIALI_01034: Heat shock response regulator Phr, ArsR family	* Methanosphaera stadtmanae DSM 3091 Site: position = -187 score = 6.04859 sequence = TTTAGTAACAAAATGTTATATAT Site: position = -153 score = 6.25812 sequence = TTTAATAACTTTTAGTTACAAAA Gene: Msp_1519: Heat shock response regulator Phr, ArsR family	* Methanothermobacter thermautotrophicus str. Delta H Site: position = -42 score = 5.5898 sequence = TATACTTACAAAAGGTTATATAA Gene: MTH1288: Heat shock response regulator Phr, ArsR family	Heat shock response regulator Phr, ArsR family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD