Regulon of Phr in Methanobrevibacter smithii DSM 2375

Properties
Regulator type:	Transcription factor
TF locus tag:	METSMIALI_01034
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Methanobacteriales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 6.2 Sequence: TTATATAACTTTTTGTTACTATA Locus tag: METSMIALI_01035 Name: grpE Funciton: Heat shock protein GrpE Locus tag: METSMIALI_01036 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: METSMIALI_01037 Name: dnaJ Funciton: Chaperone protein DnaJ
	METSMIALI_01035	grpE	Heat shock protein GrpE
	METSMIALI_01036	dnaK	Chaperone protein DnaK
	METSMIALI_01037	dnaJ	Chaperone protein DnaJ
Position: -46 Score: 6.2 Sequence: TATAGTAACAAAAAGTTATATAA Locus tag: METSMIALI_01034 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	METSMIALI_01034	phr	Heat shock response regulator Phr, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD