Regulon of Phr in Methanobrevibacter ruminantium M1

Properties
Regulator type:	Transcription factor
TF locus tag:	mru_2037
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Methanobacteriales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -448 Score: 5.4 Sequence: TAAAATTACTTTTTGTAAGAAAA Position: -414 Score: 6.4 Sequence: TTATATAACATTTTGTTACTAAA Locus tag: mru_2038 Name: grpE Funciton: Heat shock protein GrpE Locus tag: mru_2039 Name: dnaK Funciton: Chaperone protein DnaK
	mru_2038	grpE	Heat shock protein GrpE
	mru_2039	dnaK	Chaperone protein DnaK
Position: -238 Score: 6.4 Sequence: TTTAGTAACAAAATGTTATATAA Position: -149 Score: 5.8 Sequence: TTTAGTAACAAAAAGTTAATATA Locus tag: mru_2037 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	mru_2037	phr	Heat shock response regulator Phr, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD