Regulon of Phr in Methanosphaera stadtmanae DSM 3091

Properties
Regulator type:	Transcription factor
TF locus tag:	Msp_1519
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Methanobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Methanobacteriales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -187 Score: 6 Sequence: TTTAGTAACAAAATGTTATATAT Position: -153 Score: 6.3 Sequence: TTTAATAACTTTTAGTTACAAAA Locus tag: Msp_1519 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	Msp_1519	phr	Heat shock response regulator Phr, ArsR family
Position: -156 Score: 6.3 Sequence: TTTTGTAACTAAAAGTTATTAAA Position: -122 Score: 6 Sequence: ATATATAACATTTTGTTACTAAA Locus tag: Msp_1518 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Msp_1517 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Msp_1516 Name: dnaJ Funciton: Chaperone protein DnaJ
	Msp_1518	grpE	Heat shock protein GrpE
	Msp_1517	dnaK	Chaperone protein DnaK
	Msp_1516	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD