Regulog MdxR - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltodextrin utilization; Maltose utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltodextrin utilization
- By pathway - Maltose utilization
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 6 | 2 |
| Listeria monocytogenes EGD-e | 6 | 2 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | 6 | 2 |
| Listeria welshimeri serovar 6b str. SLCC5334 | 6 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| mdxE |
*
Listeria innocua Clip11262 Site: position = -172 score = 5.85679 sequence = TGTTGTTATCGGTAACATGT Gene: lin2230: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein |
*
Listeria monocytogenes EGD-e Site: position = -171 score = 5.85679 sequence = TGTTGTTATCGGTAACATGT Gene: lmo2125: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -171 score = 5.85679 sequence = TGTTGTTATCGGTAACATGT Gene: lse_2114: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -170 score = 5.85679 sequence = TGTTGTTATCGGTAACATGT Gene: lwe2145: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein |
Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein |
| mdxF |
Gene: lin2229: Maltose/Maltodextrin ABC transporter, permease protein |
Gene: lmo2124: Maltose/Maltodextrin ABC transporter, permease protein |
Gene: lse_2113: Maltose/Maltodextrin ABC transporter, permease protein |
Gene: lwe2144: Maltose/Maltodextrin ABC transporter, permease protein |
Maltose/Maltodextrin ABC transporter, permease protein |
| mdxG |
Gene: lin2228: Maltose/Maltodextrin ABC transporter, permease protein |
Gene: lmo2123: Maltose/Maltodextrin ABC transporter, permease protein |
Gene: lse_2112: Maltose/Maltodextrin ABC transporter, permease protein |
Gene: lwe2143: Maltose/Maltodextrin ABC transporter, permease protein |
Maltose/Maltodextrin ABC transporter, permease protein |
| malA |
Gene: lin2227: Putative maltodextrin utilization protein |
Gene: lmo2122: Putative maltodextrin utilization protein |
Gene: lse_2111: Putative maltodextrin utilization protein |
Gene: lwe2142: Putative maltodextrin utilization protein |
Putative maltodextrin utilization protein |
| malK |
Gene: lin2226: Maltose phosphorylase (EC 2.4.1.8) |
Gene: lmo2121: Maltose phosphorylase (EC 2.4.1.8) |
Gene: lse_2110: Maltose phosphorylase (EC 2.4.1.8) |
Gene: lwe2141: Maltose phosphorylase (EC 2.4.1.8) |
Maltose phosphorylase (EC 2.4.1.8) |
| CRON 2. | |||||
| mdxD |
*
Listeria innocua Clip11262 Site: position = -94 score = 6.51366 sequence = TCTTGTTACCGTTAACGAGC Gene: lin2231: Intracellular maltogenic amylase |
*
Listeria monocytogenes EGD-e Site: position = -94 score = 6.51366 sequence = TCTTGTTACCGTTAACGAGC Gene: lmo2126: Intracellular maltogenic amylase |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -95 score = 6.51366 sequence = TCTTGTTACCGTTAACGAGC Gene: lse_2115: Intracellular maltogenic amylase |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -94 score = 6.51366 sequence = TCTTGTTACCGTTAACGAGC Gene: lwe2146: Intracellular maltogenic amylase |
Intracellular maltogenic amylase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |