Orthologous regulated operons containing mdxG gene

Properties
Regulog:	MdxR - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -172 Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT Locus tag: lin2230 Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein Locus tag: lin2229 Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lin2228 Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lin2227 Name: malA Funciton: Putative maltodextrin utilization protein Locus tag: lin2226 Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK	-172	5.9	TGTTGTTATCGGTAACATGT	lin2230
Listeria monocytogenes EGD-e
Position: -171 Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT Locus tag: lmo2125 Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein Locus tag: lmo2124 Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lmo2123 Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lmo2122 Name: malA Funciton: Putative maltodextrin utilization protein Locus tag: lmo2121 Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK	-171	5.9	TGTTGTTATCGGTAACATGT	lmo2125
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -171 Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT Locus tag: lse_2114 Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein Locus tag: lse_2113 Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lse_2112 Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lse_2111 Name: malA Funciton: Putative maltodextrin utilization protein Locus tag: lse_2110 Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK	-171	5.9	TGTTGTTATCGGTAACATGT	lse_2114
Listeria welshimeri serovar 6b str. SLCC5334
Position: -170 Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT Locus tag: lwe2145 Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein Locus tag: lwe2144 Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lwe2143 Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lwe2142 Name: malA Funciton: Putative maltodextrin utilization protein Locus tag: lwe2141 Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK	-170	5.9	TGTTGTTATCGGTAACATGT	lwe2145