Regulon of MdxR in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe2148
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Regulog:	MdxR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltodextrin utilization
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -170 Score: 5.9 Sequence: TGTTGTTATCGGTAACATGT Locus tag: lwe2145 Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein Locus tag: lwe2144 Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lwe2143 Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lwe2142 Name: malA Funciton: Putative maltodextrin utilization protein Locus tag: lwe2141 Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
	lwe2145	mdxE	Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
	lwe2144	mdxF	Maltose/Maltodextrin ABC transporter, permease protein
	lwe2143	mdxG	Maltose/Maltodextrin ABC transporter, permease protein
	lwe2142	malA	Putative maltodextrin utilization protein
	lwe2141	malK	Maltose phosphorylase (EC 2.4.1.8)
Position: -94 Score: 6.5 Sequence: TCTTGTTACCGTTAACGAGC Locus tag: lwe2146 Name: mdxD Funciton: Intracellular maltogenic amylase
	lwe2146	mdxD	Intracellular maltogenic amylase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD