Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing malK gene

Properties
Regulog: MdxR - Listeriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltodextrin utilization; Maltose utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -172
Score: 5.85679
Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lin2230
Name: mdxE
Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lin2229
Name: mdxF
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lin2228
Name: mdxG
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lin2227
Name: malA
Funciton: Putative maltodextrin utilization protein
Locus tag: lin2226
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK -172 5.9 TGTTGTTATCGGTAACATGT lin2230
Listeria monocytogenes EGD-e
Position: -171
Score: 5.85679
Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lmo2125
Name: mdxE
Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lmo2124
Name: mdxF
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lmo2123
Name: mdxG
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lmo2122
Name: malA
Funciton: Putative maltodextrin utilization protein
Locus tag: lmo2121
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK -171 5.9 TGTTGTTATCGGTAACATGT lmo2125
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -171
Score: 5.85679
Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lse_2114
Name: mdxE
Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lse_2113
Name: mdxF
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lse_2112
Name: mdxG
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lse_2111
Name: malA
Funciton: Putative maltodextrin utilization protein
Locus tag: lse_2110
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK -171 5.9 TGTTGTTATCGGTAACATGT lse_2114
Listeria welshimeri serovar 6b str. SLCC5334
Position: -170
Score: 5.85679
Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lwe2145
Name: mdxE
Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lwe2144
Name: mdxF
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lwe2143
Name: mdxG
Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lwe2142
Name: malA
Funciton: Putative maltodextrin utilization protein
Locus tag: lwe2141
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
mdxE-mdxF-mdxG-malA-malK -170 5.9 TGTTGTTATCGGTAACATGT lwe2145