Regulon of MdxR in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_2117
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Regulog:	MdxR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltodextrin utilization
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 6.5 Sequence: TCTTGTTACCGTTAACGAGC Locus tag: lse_2115 Name: mdxD Funciton: Intracellular maltogenic amylase
	lse_2115	mdxD	Intracellular maltogenic amylase
Position: -171 Score: 5.9 Sequence: TGTTGTTATCGGTAACATGT Locus tag: lse_2114 Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein Locus tag: lse_2113 Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lse_2112 Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein Locus tag: lse_2111 Name: malA Funciton: Putative maltodextrin utilization protein Locus tag: lse_2110 Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8)
	lse_2114	mdxE	Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
	lse_2113	mdxF	Maltose/Maltodextrin ABC transporter, permease protein
	lse_2112	mdxG	Maltose/Maltodextrin ABC transporter, permease protein
	lse_2111	malA	Putative maltodextrin utilization protein
	lse_2110	malK	Maltose phosphorylase (EC 2.4.1.8)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD