Regulog THA_1503 - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Fervidobacterium nodosum Rt17-B1 | 4 | 1 |
| Petrotoga mobilis SJ95 | 4 | 1 |
| Thermosipho africanus TCF52B | 4 | 1 |
| Thermosipho melanesiensis BI429 | 4 | 1 |
| Thermotoga lettingae TMO | 4 | 1 |
| Thermotoga maritima MSB8 | ||
| Thermotoga naphthophila RKU-10 | ||
| Thermotoga neapolitana DSM 4359 | ||
| Thermotoga petrophila RKU-1 | ||
| Thermotoga sp. RQ2 | ||
| Thermotogales bacterium TBF 19.5.1 | 4 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| THA_1504 |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -77 score = 7.50011 sequence = AGTGTTATATAATTATATAACACT Gene: Fnod_0542: hypothetical protein |
*
Petrotoga mobilis SJ95 Site: position = -46 score = 6.1537 sequence = TGTGTTATAGTTAAATATAACAAC Gene: Pmob_0665: hypothetical protein |
*
Thermosipho africanus TCF52B Site: position = -56 score = 6.66318 sequence = TGTGTTATACTTTTATAGAACACT Gene: THA_1504: hypothetical protein |
*
Thermosipho melanesiensis BI429 Site: position = -1 score = 6.40059 sequence = TGTGTTATACTTATATAGAACAAT Gene: Tmel_1358: hypothetical protein |
*
Thermotoga lettingae TMO Site: position = -46 score = 6.45247 sequence = AGTGTTCTAATAATATAGAACAAT Gene: Tlet_0734: hypothetical protein |
|
|
|
|
|
*
Thermotogales bacterium TBF 19.5.1 Site: position = -49 score = 6.25601 sequence = AGTGTTCTAATAAAGTAGAACACT Gene: Kole_0655: hypothetical protein |
hypothetical protein |
| THA_1503 |
Gene: Fnod_0541: Transcriptional regulator, GntR family |
Gene: Pmob_0664: Transcriptional regulator, GntR family |
Gene: THA_1503: Transcriptional regulator, GntR family |
Gene: Tmel_1357: Transcriptional regulator, GntR family |
Gene: Tlet_0735: Transcriptional regulator, GntR family |
|
|
|
|
|
Gene: Kole_0656: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| THA_1502 |
Gene: Fnod_0540: ABC transporter, permease protein |
Gene: Pmob_0663: ABC transporter, permease protein |
Gene: THA_1502: ABC transporter, permease protein |
Gene: Tmel_1356: ABC transporter, permease protein |
Gene: Tlet_0736: ABC transporter, permease protein |
|
|
|
|
|
Gene: Kole_0657: ABC transporter, permease protein |
ABC transporter, permease protein |
| THA_1501 |
Gene: Fnod_0539: ABC transporter, ATP-binding protein |
Gene: Pmob_0662: ABC transporter, ATP-binding protein |
Gene: THA_1501: ABC transporter, ATP-binding protein |
Gene: Tmel_1355: ABC transporter, ATP-binding protein |
Gene: Tlet_0737: ABC transporter, ATP-binding protein |
|
|
|
|
|
Gene: Kole_0658: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |