Regulon of THA_1503 in Thermotogales bacterium TBF 19.5.1

Properties
Regulator type:	Transcription factor
TF locus tag:	Kole_0656
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	THA_1503 - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.3 Sequence: AGTGTTCTAATAAAGTAGAACACT Locus tag: Kole_0655 Name: THA_1504 Funciton: hypothetical protein Locus tag: Kole_0656 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Kole_0657 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Kole_0658 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
	Kole_0655	THA_1504	hypothetical protein
	Kole_0656	THA_1503	Transcriptional regulator, GntR family
	Kole_0657	THA_1502	ABC transporter, permease protein
	Kole_0658	THA_1501	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD