Regulon of THA_1503 in Fervidobacterium nodosum Rt17-B1

Properties
Regulator type:	Transcription factor
TF locus tag:	Fnod_0541
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	THA_1503 - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 7.5 Sequence: AGTGTTATATAATTATATAACACT Locus tag: Fnod_0542 Name: THA_1504 Funciton: hypothetical protein Locus tag: Fnod_0541 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Fnod_0540 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Fnod_0539 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
	Fnod_0542	THA_1504	hypothetical protein
	Fnod_0541	THA_1503	Transcriptional regulator, GntR family
	Fnod_0540	THA_1502	ABC transporter, permease protein
	Fnod_0539	THA_1501	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD