Regulon of THA_1503 in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_1357
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	THA_1503 - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -1 Score: 6.4 Sequence: TGTGTTATACTTATATAGAACAAT Locus tag: Tmel_1358 Name: THA_1504 Funciton: hypothetical protein Locus tag: Tmel_1357 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Tmel_1356 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Tmel_1355 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
	Tmel_1358	THA_1504	hypothetical protein
	Tmel_1357	THA_1503	Transcriptional regulator, GntR family
	Tmel_1356	THA_1502	ABC transporter, permease protein
	Tmel_1355	THA_1501	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD