Regulog Cg3261 - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | 3 | 1 |
| Corynebacterium aurimucosum ATCC 700975 | 3 | 1 |
| Corynebacterium diphtheriae NCTC 13129 | 3 | 1 |
| Corynebacterium efficiens YS-314 | 1 | 1 |
| Corynebacterium glutamicum ATCC 13032 | 1 | 1 |
| Corynebacterium jeikeium K411 | 3 | 1 |
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 | 6 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| lp_2742 |
*
Corynebacterium amycolatum SK46 Site: position = -47 score = 3.8592 sequence = TTAGGTTTATGACATAGGTGGTATACCCGT Gene: CORAM0001_0934: Transcriptional regulator, GntR family |
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -42 score = 6.495 sequence = TATGGTTAGCTACATGAGTAACCAACCAGC Gene: cauri_2429: Transcriptional regulator, GntR family |
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -33 score = 7.01529 sequence = TATGGTTAGTTACATGAGTAACCAACCAAC Gene: DIP2280: Transcriptional regulator, GntR family |
*
Corynebacterium efficiens YS-314 Site: position = -50 score = 6.50475 sequence = TAGGGTTAGTTACCTGAGTAACTAACCAAT Gene: CE2809: Transcriptional regulator, GntR family |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -39 score = 6.38365 sequence = TAGGGTTAGTTATATGAGTAACCAACCATC Gene: cg3261: Transcriptional regulator, GntR family |
*
Corynebacterium jeikeium K411 Site: position = -109 score = 7.01529 sequence = TATGGTTAGTTACACAAGTAACCAACCAAC Gene: jk0088: Transcriptional regulator, GntR family |
|
*2
Corynebacterium urealyticum DSM 7109 Site: position = -124 score = 6.80932 sequence = TATGGTTGGTTACACAAGTAACTAACCGAC Gene: cur_0107: Transcriptional regulator, GntR family Site: position = -17 score = 3.45318 sequence = TTAGGTTTATGACCTACATGGTAAACCCCA Gene: cur_1282: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| lp_2743 |
Gene: CORAM0001_0935: ABC-type multidrug transport system, ATPase component |
Gene: cauri_2428: ABC-type multidrug transport system, ATPase component |
Gene: DIP2279: ABC-type multidrug transport system, ATPase component |
|
|
Gene: jk0089: ABC-type multidrug transport system, ATPase component |
Gene: ckrop_0085: ABC-type multidrug transport system, ATPase component |
2
Corynebacterium urealyticum DSM 7109 Gene: cur_0108: ABC-type multidrug transport system, ATPase component Gene: cur_1281: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| lp_2744 |
Gene: CORAM0001_0936: ABC-type multidrug transport system, permease component |
Gene: cauri_2427: ABC-type multidrug transport system, permease component |
Gene: DIP2278: ABC-type multidrug transport system, permease component |
|
|
Gene: jk0090: ABC-type multidrug transport system, permease component |
Gene: ckrop_0086: ABC-type multidrug transport system, permease component |
2
Corynebacterium urealyticum DSM 7109 Gene: cur_0109: ABC-type multidrug transport system, permease component Gene: cur_1280: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |