Regulon of Cg3261 in Corynebacterium amycolatum SK46

Properties
Regulator type:	Transcription factor
TF locus tag:	CORAM0001_0934
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Cg3261 - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 3.9 Sequence: TTAGGTTTATGACATAGGTGGTATACCCGT Locus tag: CORAM0001_0934 Name: lp_2742 Funciton: Transcriptional regulator, GntR family Locus tag: CORAM0001_0935 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CORAM0001_0936 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
	CORAM0001_0934	lp_2742	Transcriptional regulator, GntR family
	CORAM0001_0935	lp_2743	ABC-type multidrug transport system, ATPase component
	CORAM0001_0936	lp_2744	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD