Regulon of Cg3261 in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg3261
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Cg3261 - Corynebacteriaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.4 Sequence: TAGGGTTAGTTATATGAGTAACCAACCATC Locus tag: cg3261 Name: lp_2742 Funciton: Transcriptional regulator, GntR family
	cg3261	lp_2742	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD