Regulog TreR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Trehalose
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Alteromonadales bacterium TW-7 | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Glaciecola sp. HTCC2999 | ||
| Colwellia psychrerythraea 34H | 5 | 4 |
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR | ||
| Pseudoalteromonas atlantica T6c | 4 | 3 |
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | 4 | 3 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| treP |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -133 score = 4.83573 sequence = AAACACTATCGATTGCATAT Site: position = -76 score = 6.41072 sequence = TTTTGCAAACGATTGCATAA Gene: CPS_0980: Trehalose phosphorylase (EC 2.4.1.64) |
|
|
|
|
|
Trehalose phosphorylase (EC 2.4.1.64) |
| pgm2 |
|
|
|
Gene: CPS_0979: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
|
|
|
|
Beta-phosphoglucomutase (EC 5.4.2.6) |
| CRON 2. | ||||||||||
| treR |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -94 score = 6.11775 sequence = TAATGCAATCGATTGCAAGG Site: position = -71 score = 5.9052 sequence = TTTTACAATCGATTGCATTG Gene: CPS_0978: Transcriptional regulator of trehalose utilization, LacI family |
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -381 score = 6.41151 sequence = AAATGCAAACGATTGCAATT Site: position = -357 score = 6.41112 sequence = TTTTGCAATCGTTTGCATTT Gene: Patl_1823: Transcriptional regulator of trehalose utilization, LacI family |
|
*
Pseudoalteromonas tunicata D2 Site: position = -165 score = 6.41112 sequence = TTATGCAAACGTTTGCAATT Gene: PTD2_20307: Transcriptional regulator of trehalose utilization, LacI family |
Transcriptional regulator of trehalose utilization, LacI family |
| CRON 3. | ||||||||||
| treT |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -94 score = 4.83573 sequence = ATATGCAATCGATAGTGTTT Site: position = -151 score = 6.41072 sequence = TTATGCAATCGTTTGCAAAA Gene: CPS_0981: Predicted trehalose permease, MFS family, FucP subfamily |
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -73 score = 6.21623 sequence = GAATGCAAACGATTGCATTT Gene: Patl_1824: Predicted trehalose permease, MFS family, FucP subfamily |
|
*
Pseudoalteromonas tunicata D2 Site: position = -113 score = 6.41151 sequence = AAATGCAAACGTTTGCATTT Gene: PTD2_20312: Predicted trehalose permease, MFS family, FucP subfamily |
Predicted trehalose permease, MFS family, FucP subfamily |
| treF |
|
|
|
|
|
|
Gene: Patl_1825: Trehalase (EC 3.2.1.28) |
|
Gene: PTD2_20317: Trehalase (EC 3.2.1.28) |
Trehalase (EC 3.2.1.28) |
| CRON 4. | ||||||||||
| omp(Tre) |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -142 score = 5.9052 sequence = CAATGCAATCGATTGTAAAA Site: position = -119 score = 6.11775 sequence = CCTTGCAATCGATTGCATTA Gene: CPS_0977: Trehalose-regulated TonB-dependent outer membrane receptor |
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -64 score = 6.41151 sequence = AATTGCAATCGTTTGCATTT Site: position = -88 score = 6.41112 sequence = AAATGCAAACGATTGCAAAA Gene: Patl_1822: Trehalose-regulated TonB-dependent outer membrane receptor |
|
*
Pseudoalteromonas tunicata D2 Site: position = -124 score = 6.41112 sequence = AATTGCAAACGTTTGCATAA Gene: PTD2_20302: Trehalose-regulated TonB-dependent outer membrane receptor |
Trehalose-regulated TonB-dependent outer membrane receptor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |