Regulon of TreR in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_1823
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.2 Sequence: GAATGCAAACGATTGCATTT Locus tag: Patl_1824 Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily Locus tag: Patl_1825 Name: treF Funciton: Trehalase (EC 3.2.1.28)
	Patl_1824	treT	Predicted trehalose permease, MFS family, FucP subfamily
	Patl_1825	treF	Trehalase (EC 3.2.1.28)
Position: -88 Score: 6.4 Sequence: AAATGCAAACGATTGCAAAA Position: -64 Score: 6.4 Sequence: AATTGCAATCGTTTGCATTT Locus tag: Patl_1822 Name: omp(Tre) Funciton: Trehalose-regulated TonB-dependent outer membrane receptor
	Patl_1822	omp(Tre)	Trehalose-regulated TonB-dependent outer membrane receptor
Position: -381 Score: 6.4 Sequence: AAATGCAAACGATTGCAATT Position: -357 Score: 6.4 Sequence: TTTTGCAATCGTTTGCATTT Locus tag: Patl_1823 Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family
	Patl_1823	treR	Transcriptional regulator of trehalose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD