Regulon of TreR in Colwellia psychrerythraea 34H

Properties
Regulator type:	Transcription factor
TF locus tag:	CPS_0978
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 4.8 Sequence: AAACACTATCGATTGCATAT Position: -76 Score: 6.4 Sequence: TTTTGCAAACGATTGCATAA Locus tag: CPS_0980 Name: null Funciton: Trehalose phosphorylase (EC 2.4.1.64) Locus tag: CPS_0979 Name: pgm2 Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
	CPS_0980		Trehalose phosphorylase (EC 2.4.1.64)
	CPS_0979	pgm2	Beta-phosphoglucomutase (EC 5.4.2.6)
Position: -151 Score: 6.4 Sequence: TTATGCAATCGTTTGCAAAA Position: -94 Score: 4.8 Sequence: ATATGCAATCGATAGTGTTT Locus tag: CPS_0981 Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily
	CPS_0981	treT	Predicted trehalose permease, MFS family, FucP subfamily
Position: -142 Score: 5.9 Sequence: CAATGCAATCGATTGTAAAA Position: -119 Score: 6.1 Sequence: CCTTGCAATCGATTGCATTA Locus tag: CPS_0977 Name: omp(Tre) Funciton: Trehalose-regulated TonB-dependent outer membrane receptor
	CPS_0977	omp(Tre)	Trehalose-regulated TonB-dependent outer membrane receptor
Position: -94 Score: 6.1 Sequence: TAATGCAATCGATTGCAAGG Position: -71 Score: 5.9 Sequence: TTTTACAATCGATTGCATTG Locus tag: CPS_0978 Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family
	CPS_0978	treR	Transcriptional regulator of trehalose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD