Regulon of TreR in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_20307
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	TreR - Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -165 Score: 6.4 Sequence: TTATGCAAACGTTTGCAATT Locus tag: PTD2_20307 Name: treR Funciton: Transcriptional regulator of trehalose utilization, LacI family
	PTD2_20307	treR	Transcriptional regulator of trehalose utilization, LacI family
Position: -113 Score: 6.4 Sequence: AAATGCAAACGTTTGCATTT Locus tag: PTD2_20312 Name: treT Funciton: Predicted trehalose permease, MFS family, FucP subfamily Locus tag: PTD2_20317 Name: treF Funciton: Trehalase (EC 3.2.1.28)
	PTD2_20312	treT	Predicted trehalose permease, MFS family, FucP subfamily
	PTD2_20317	treF	Trehalase (EC 3.2.1.28)
Position: -124 Score: 6.4 Sequence: AATTGCAAACGTTTGCATAA Locus tag: PTD2_20302 Name: omp(Tre) Funciton: Trehalose-regulated TonB-dependent outer membrane receptor
	PTD2_20302	omp(Tre)	Trehalose-regulated TonB-dependent outer membrane receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD