Regulog SCO5692 - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 9 | 3 |
| Streptomyces coelicolor A3(2) | 8 | 3 |
| Streptomyces griseus subsp. griseus NBRC 13350 | ||
| Streptomyces scabiei 87.22 | 8 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| SAV_2577 |
*
Streptomyces avermitilis MA-4680 Site: position = -151 score = 6.60343 sequence = ACATCGAAGCGCTTCGACTC Gene: SAV_2577: Predicted multiple sugar ABC transporter, substrate-binding protein |
*
Streptomyces coelicolor A3(2) Site: position = -218 score = 6.3476 sequence = ACGTCGAAGCGCTTCGATGC Site: position = -109 score = 6.68391 sequence = ACATCGAAGCGCTTCGACAC Gene: SCO5686: Predicted multiple sugar ABC transporter, substrate-binding protein |
|
*
Streptomyces scabiei 87.22 Site: position = -151 score = 6.71373 sequence = ACATCGAAGCGCTTCGACTG Gene: SCAB_25621: Predicted multiple sugar ABC transporter, substrate-binding protein |
Predicted multiple sugar ABC transporter, substrate-binding protein |
| SAV_2576 |
Gene: SAV_2576: Predicted multiple sugar ABC transporter, permease protein 1 |
Gene: SCO5687: Predicted multiple sugar ABC transporter, permease protein 1 |
|
Gene: SCAB_25611: Predicted multiple sugar ABC transporter, permease protein 1 |
Predicted multiple sugar ABC transporter, permease protein 1 |
| SAV_2575 |
Gene: SAV_2575: Predicted multiple sugar ABC transporter, permease protein 2 |
Gene: SCO5688: Predicted multiple sugar ABC transporter, permease protein 2 |
|
Gene: SCAB_25601: Predicted multiple sugar ABC transporter, permease protein 2 |
Predicted multiple sugar ABC transporter, permease protein 2 |
| SAV_2574 |
Gene: SAV_2574: Predicted glycosyl hydrolase |
|
|
Gene: SCAB_25591: Predicted glycosyl hydrolase |
Predicted glycosyl hydrolase |
| SAV_2573 |
Gene: SAV_2573: Beta-galactosidase (EC 3.2.1.23) |
Gene: SCO5689: Beta-galactosidase (EC 3.2.1.23) |
|
Gene: SCAB_25581: Beta-galactosidase (EC 3.2.1.23) |
Beta-galactosidase (EC 3.2.1.23) |
| SAV_2572 |
Gene: SAV_2572: Predicted secreted protein |
Gene: SCO5690: Predicted secreted protein |
|
|
Predicted secreted protein |
| SAV_2571 |
Gene: SAV_2571: Predicted sugar hydrolase |
Gene: SCO5691: Predicted sugar hydrolase |
|
Gene: SCAB_25571: Predicted sugar hydrolase |
Predicted sugar hydrolase |
| CRON 2. | |||||
| SCO5692 |
*
Streptomyces avermitilis MA-4680 Site: position = -125 score = 6.59019 sequence = TTGTCGAAGCGCTTCGACAG Gene: SAV_2569: Predicted sugar utilization transcriptional regulator, LacI family |
*
Streptomyces coelicolor A3(2) Site: position = -124 score = 6.86448 sequence = GAGTCGAAGCGCTTCGACGG Gene: SCO5692: Predicted sugar utilization transcriptional regulator, LacI family |
|
*
Streptomyces scabiei 87.22 Site: position = -125 score = 6.3048 sequence = TGATCGAAGCGCTTCGACAA Gene: SCAB_25511: Predicted sugar utilization transcriptional regulator, LacI family |
Predicted sugar utilization transcriptional regulator, LacI family |
| CRON 3. | |||||
| bglX |
*
Streptomyces avermitilis MA-4680 Site: position = -53 score = 6.54262 sequence = GCATCGAAGCGCTTCGAAAG Site: position = -235 score = 6.33266 sequence = GAGTCGAAGCGCTTCGATGT Gene: SAV_2578: Glycoside hydrolase |
*
Streptomyces coelicolor A3(2) Site: position = -51 score = 6.73456 sequence = GCATCGAAGCGCTTCGACGT Site: position = -160 score = 6.22831 sequence = GTGTCGAAGCGCTTCGATGT Gene: SCO5685: Glycoside hydrolase |
|
*
Streptomyces scabiei 87.22 Site: position = -53 score = 6.54262 sequence = GCATCGAAGCGCTTCGAAAG Site: position = -248 score = 6.16273 sequence = CAGTCGAAGCGCTTCGATGT Gene: SCAB_25641: Glycoside hydrolase |
Glycoside hydrolase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |