Regulog SCO5692 - Streptomycetaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Streptomyces avermitilis MA-4680	9	3
Streptomyces coelicolor A3(2)	8	3
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22	8	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
SAV_2577	* Streptomyces avermitilis MA-4680 Site: position = -151 score = 6.60343 sequence = ACATCGAAGCGCTTCGACTC Gene: SAV_2577: Predicted multiple sugar ABC transporter, substrate-binding protein	* Streptomyces coelicolor A3(2) Site: position = -218 score = 6.3476 sequence = ACGTCGAAGCGCTTCGATGC Site: position = -109 score = 6.68391 sequence = ACATCGAAGCGCTTCGACAC Gene: SCO5686: Predicted multiple sugar ABC transporter, substrate-binding protein	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -151 score = 6.71373 sequence = ACATCGAAGCGCTTCGACTG Gene: SCAB_25621: Predicted multiple sugar ABC transporter, substrate-binding protein	Predicted multiple sugar ABC transporter, substrate-binding protein
SAV_2576	Streptomyces avermitilis MA-4680 Gene: SAV_2576: Predicted multiple sugar ABC transporter, permease protein 1	Streptomyces coelicolor A3(2) Gene: SCO5687: Predicted multiple sugar ABC transporter, permease protein 1	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_25611: Predicted multiple sugar ABC transporter, permease protein 1	Predicted multiple sugar ABC transporter, permease protein 1
SAV_2575	Streptomyces avermitilis MA-4680 Gene: SAV_2575: Predicted multiple sugar ABC transporter, permease protein 2	Streptomyces coelicolor A3(2) Gene: SCO5688: Predicted multiple sugar ABC transporter, permease protein 2	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_25601: Predicted multiple sugar ABC transporter, permease protein 2	Predicted multiple sugar ABC transporter, permease protein 2
SAV_2574	Streptomyces avermitilis MA-4680 Gene: SAV_2574: Predicted glycosyl hydrolase	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_25591: Predicted glycosyl hydrolase	Predicted glycosyl hydrolase
SAV_2573	Streptomyces avermitilis MA-4680 Gene: SAV_2573: Beta-galactosidase (EC 3.2.1.23)	Streptomyces coelicolor A3(2) Gene: SCO5689: Beta-galactosidase (EC 3.2.1.23)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_25581: Beta-galactosidase (EC 3.2.1.23)	Beta-galactosidase (EC 3.2.1.23)
SAV_2572	Streptomyces avermitilis MA-4680 Gene: SAV_2572: Predicted secreted protein	Streptomyces coelicolor A3(2) Gene: SCO5690: Predicted secreted protein	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Predicted secreted protein
SAV_2571	Streptomyces avermitilis MA-4680 Gene: SAV_2571: Predicted sugar hydrolase	Streptomyces coelicolor A3(2) Gene: SCO5691: Predicted sugar hydrolase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_25571: Predicted sugar hydrolase	Predicted sugar hydrolase

CRON 2.
SCO5692	* Streptomyces avermitilis MA-4680 Site: position = -125 score = 6.59019 sequence = TTGTCGAAGCGCTTCGACAG Gene: SAV_2569: Predicted sugar utilization transcriptional regulator, LacI family	* Streptomyces coelicolor A3(2) Site: position = -124 score = 6.86448 sequence = GAGTCGAAGCGCTTCGACGG Gene: SCO5692: Predicted sugar utilization transcriptional regulator, LacI family	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -125 score = 6.3048 sequence = TGATCGAAGCGCTTCGACAA Gene: SCAB_25511: Predicted sugar utilization transcriptional regulator, LacI family	Predicted sugar utilization transcriptional regulator, LacI family

CRON 3.
bglX	* Streptomyces avermitilis MA-4680 Site: position = -53 score = 6.54262 sequence = GCATCGAAGCGCTTCGAAAG Site: position = -235 score = 6.33266 sequence = GAGTCGAAGCGCTTCGATGT Gene: SAV_2578: Glycoside hydrolase	* Streptomyces coelicolor A3(2) Site: position = -51 score = 6.73456 sequence = GCATCGAAGCGCTTCGACGT Site: position = -160 score = 6.22831 sequence = GTGTCGAAGCGCTTCGATGT Gene: SCO5685: Glycoside hydrolase	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -53 score = 6.54262 sequence = GCATCGAAGCGCTTCGAAAG Site: position = -248 score = 6.16273 sequence = CAGTCGAAGCGCTTCGATGT Gene: SCAB_25641: Glycoside hydrolase	Glycoside hydrolase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SCO5692 - Streptomycetaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --