Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SAV_2577 gene

Properties
Regulog: SCO5692 - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -151
Score: 6.60343
Sequence: ACATCGAAGCGCTTCGACTC
Locus tag: SAV_2577
Name: SAV_2577
Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SAV_2576
Name: SAV_2576
Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SAV_2575
Name: SAV_2575
Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SAV_2574
Name: SAV_2574
Funciton: Predicted glycosyl hydrolase
Locus tag: SAV_2573
Name: SAV_2573
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SAV_2572
Name: SAV_2572
Funciton: Predicted secreted protein
Locus tag: SAV_2571
Name: SAV_2571
Funciton: Predicted sugar hydrolase
SAV_2577-SAV_2576-SAV_2575-SAV_2574-SAV_2573-SAV_2572-SAV_2571 -151 6.6 ACATCGAAGCGCTTCGACTC SAV_2577
Streptomyces coelicolor A3(2)
Position: -218
Score: 6.3476
Sequence: ACGTCGAAGCGCTTCGATGC
Position: -109
Score: 6.68391
Sequence: ACATCGAAGCGCTTCGACAC
Locus tag: SCO5686
Name: SAV_2577
Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SCO5687
Name: SAV_2576
Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SCO5688
Name: SAV_2575
Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SCO5689
Name: SAV_2573
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCO5690
Name: SAV_2572
Funciton: Predicted secreted protein
Locus tag: SCO5691
Name: SAV_2571
Funciton: Predicted sugar hydrolase
SAV_2577-SAV_2576-SAV_2575-SAV_2573-SAV_2572-SAV_2571 -218 6.3 ACGTCGAAGCGCTTCGATGC SCO5686
-109 6.7 ACATCGAAGCGCTTCGACAC
Streptomyces scabiei 87.22
Position: -151
Score: 6.71373
Sequence: ACATCGAAGCGCTTCGACTG
Locus tag: SCAB_25621
Name: SAV_2577
Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SCAB_25611
Name: SAV_2576
Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SCAB_25601
Name: SAV_2575
Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SCAB_25591
Name: SAV_2574
Funciton: Predicted glycosyl hydrolase
Locus tag: SCAB_25581
Name: SAV_2573
Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCAB_25571
Name: SAV_2571
Funciton: Predicted sugar hydrolase
SAV_2577-SAV_2576-SAV_2575-SAV_2574-SAV_2573-SAV_2571 -151 6.7 ACATCGAAGCGCTTCGACTG SCAB_25621