Regulon of SCO5692 in Streptomyces avermitilis MA-4680

Properties
Regulator type:	Transcription factor
TF locus tag:	SAV_2569
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SCO5692 - Streptomycetaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -235 Score: 6.3 Sequence: GAGTCGAAGCGCTTCGATGT Position: -53 Score: 6.5 Sequence: GCATCGAAGCGCTTCGAAAG Locus tag: SAV_2578 Name: bglX Funciton: Glycoside hydrolase
	SAV_2578	bglX	Glycoside hydrolase
Position: -151 Score: 6.6 Sequence: ACATCGAAGCGCTTCGACTC Locus tag: SAV_2577 Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein Locus tag: SAV_2576 Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1 Locus tag: SAV_2575 Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2 Locus tag: SAV_2574 Name: SAV_2574 Funciton: Predicted glycosyl hydrolase Locus tag: SAV_2573 Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SAV_2572 Name: SAV_2572 Funciton: Predicted secreted protein Locus tag: SAV_2571 Name: SAV_2571 Funciton: Predicted sugar hydrolase
	SAV_2577	SAV_2577	Predicted multiple sugar ABC transporter, substrate-binding protein
	SAV_2576	SAV_2576	Predicted multiple sugar ABC transporter, permease protein 1
	SAV_2575	SAV_2575	Predicted multiple sugar ABC transporter, permease protein 2
	SAV_2574	SAV_2574	Predicted glycosyl hydrolase
	SAV_2573	SAV_2573	Beta-galactosidase (EC 3.2.1.23)
	SAV_2572	SAV_2572	Predicted secreted protein
	SAV_2571	SAV_2571	Predicted sugar hydrolase
Position: -125 Score: 6.6 Sequence: TTGTCGAAGCGCTTCGACAG Locus tag: SAV_2569 Name: SCO5692 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	SAV_2569	SCO5692	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD