Regulon of SCO5692 in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO5692
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SCO5692 - Streptomycetaceae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -160 Score: 6.2 Sequence: GTGTCGAAGCGCTTCGATGT Position: -51 Score: 6.7 Sequence: GCATCGAAGCGCTTCGACGT Locus tag: SCO5685 Name: bglX Funciton: Glycoside hydrolase
	SCO5685	bglX	Glycoside hydrolase
Position: -124 Score: 6.9 Sequence: GAGTCGAAGCGCTTCGACGG Locus tag: SCO5692 Name: SCO5692 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	SCO5692	SCO5692	Predicted sugar utilization transcriptional regulator, LacI family
Position: -218 Score: 6.3 Sequence: ACGTCGAAGCGCTTCGATGC Position: -109 Score: 6.7 Sequence: ACATCGAAGCGCTTCGACAC Locus tag: SCO5686 Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein Locus tag: SCO5687 Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1 Locus tag: SCO5688 Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2 Locus tag: SCO5689 Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SCO5690 Name: SAV_2572 Funciton: Predicted secreted protein Locus tag: SCO5691 Name: SAV_2571 Funciton: Predicted sugar hydrolase
	SCO5686	SAV_2577	Predicted multiple sugar ABC transporter, substrate-binding protein
	SCO5687	SAV_2576	Predicted multiple sugar ABC transporter, permease protein 1
	SCO5688	SAV_2575	Predicted multiple sugar ABC transporter, permease protein 2
	SCO5689	SAV_2573	Beta-galactosidase (EC 3.2.1.23)
	SCO5690	SAV_2572	Predicted secreted protein
	SCO5691	SAV_2571	Predicted sugar hydrolase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD