Regulog RhaR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By effector - Rhamnose
- By pathway - Rhamnose utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 11 | 4 |
| Arthrobacter chlorophenolicus A6 | 19 | 5 |
| Arthrobacter sp. FB24 | 18 | 7 |
| Beutenbergia cavernae DSM 12333 | 3 | 1 |
| Brachybacterium faecium DSM 4810 | 7 | 4 |
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| ramA |
|
Gene: Achl_0426: Alfa-L-rhamnosidase (EC 3.2.1.40) |
Gene: Arth_1838: Alfa-L-rhamnosidase (EC 3.2.1.40) |
|
*
Brachybacterium faecium DSM 4810 Site: position = -91 score = 4.62958 sequence = AGCTTGAGTCGTTTCACACC Gene: Bfae_29670: Alfa-L-rhamnosidase (EC 3.2.1.40) |
|
Gene: CMM_0105: Alfa-L-rhamnosidase (EC 3.2.1.40) |
|
|
|
|
|
|
|
Alfa-L-rhamnosidase (EC 3.2.1.40) |
| CRON 2. | |||||||||||||||
| rhaY |
|
|
|
|
*
Brachybacterium faecium DSM 4810 Site: position = -136 score = 5.47225 sequence = GCTTTGAAACGAATCAATAT Gene: Bfae_28350: Predicted L-rhamnose permease RhaY |
|
|
|
|
|
|
|
|
|
Predicted L-rhamnose permease RhaY |
| ramA2 |
|
|
|
|
Gene: Bfae_28340: alpha-L-rhamnosidase |
|
|
|
|
|
|
|
|
|
alpha-L-rhamnosidase |
| CRON 3. | |||||||||||||||
| yteU |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -136 score = 5.21158 sequence = GCTGTGTAACGATTCAAAAA Gene: Achl_3116: Putative membrane enzyme for rhamnogalaturonan degradation |
*
Arthrobacter sp. FB24 Site: position = -135 score = 5.41399 sequence = ATTATGTAACGATTCAAAAT Gene: Arth_3317: Putative membrane enzyme for rhamnogalaturonan degradation |
|
|
|
|
|
|
|
|
|
|
|
Putative membrane enzyme for rhamnogalaturonan degradation |
| Achl_3115 |
|
Gene: Achl_3115: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| ytcQ |
|
*
Arthrobacter chlorophenolicus A6 Site: position = -68 score = 4.77929 sequence = GAAATGAAACGTATCAACCT Gene: Achl_3114: Predicted unsaturated rhamnogalacturonyl ABC transporter, substrate-binding component |
*
Arthrobacter sp. FB24 Site: position = -155 score = 5.09258 sequence = TGAATGAAACGTATCAATAT Gene: Arth_3316: Predicted unsaturated rhamnogalacturonyl ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
|
|
|
|
Predicted unsaturated rhamnogalacturonyl ABC transporter, substrate-binding component |
| yteP |
|
Gene: Achl_3113: Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 1 |
Gene: Arth_3315: Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
|
|
|
Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 1 |
| ytcP |
|
Gene: Achl_3112: Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 2 |
Gene: Arth_3314: Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
|
|
|
Predicted unsaturated rhamnogalacturonyl ABC transporter, permease component 2 |
| yesT |
|
Gene: Achl_3111: Rhamnogalacturonan acetylesterase |
Gene: Arth_3313: Rhamnogalacturonan acetylesterase |
|
|
|
|
|
|
|
|
|
|
|
Rhamnogalacturonan acetylesterase |
| yesU |
|
Gene: Achl_3110: hypothetical protein |
Gene: Arth_3312: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| CRON 4. | |||||||||||||||
| rhiN |
*
Arthrobacter aurescens TC1 Site: position = -91 score = 4.9468 sequence = ATATTGTATCGATTCAGAAC Gene: AAur_3309: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
*
Arthrobacter chlorophenolicus A6 Site: position = -92 score = 4.91745 sequence = ATATTGTATCGTTTCAGAAG Gene: Achl_3124: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
*
Arthrobacter sp. FB24 Site: position = -100 score = 5.06509 sequence = ATATTGTATCGTTTCAGAAA Gene: Arth_3324: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
| rhiF |
Gene: AAur_3308: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
Gene: Achl_3123: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
Gene: Arth_3323: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
| rhiG |
Gene: AAur_3307: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
Gene: Achl_3122: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
Gene: Arth_3322: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
| AAur_3306 |
Gene: AAur_3306: hypothetical protein |
Gene: Achl_3121: hypothetical protein |
Gene: Arth_3321: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| AAur_3305 |
Gene: AAur_3305: putative transmembrane efflux protein (MFS) |
Gene: Achl_3120: putative transmembrane efflux protein (MFS) |
Gene: Arth_3320: putative transmembrane efflux protein (MFS) |
|
|
|
|
|
|
|
|
|
|
|
putative transmembrane efflux protein (MFS) |
| CRON 5. | |||||||||||||||
| AAur_3304 |
*
Arthrobacter aurescens TC1 Site: position = -160 score = 5.13077 sequence = GGTTTGAATCGTTACATTTT Gene: AAur_3304: oxidoreductase domain protein |
*
Arthrobacter chlorophenolicus A6 Site: position = -123 score = 5.21158 sequence = TTTTTGAATCGTTACACAGC Gene: Achl_3117: oxidoreductase domain protein |
*
Arthrobacter sp. FB24 Site: position = -193 score = 5.41399 sequence = ATTTTGAATCGTTACATAAT Gene: Arth_3318: oxidoreductase domain protein |
|
|
|
|
|
|
|
|
|
|
|
oxidoreductase domain protein |
| ramA1 |
|
Gene: Achl_3118: alpha-L-rhamnosidase |
*
Arthrobacter sp. FB24 Site: position = -116 score = 5.3567 sequence = GCTTTGAATCGTTACATTGC Gene: Arth_1969: alpha-L-rhamnosidase |
|
|
|
|
|
|
|
|
|
|
|
alpha-L-rhamnosidase |
| CRON 6. | |||||||||||||||
| rhaM |
*
Arthrobacter aurescens TC1 Site: position = -57 score = 5.16913 sequence = AATTTGAATCGTAACAAATG Site: position = -43 score = 5.52457 sequence = CAAATGAAACGATTCAAAGA Gene: AAur_3714: L-rhamnose mutarotase |
*
Arthrobacter chlorophenolicus A6 Site: position = -57 score = 5.26867 sequence = ACTTTGAATCGTACCAATGA Site: position = -44 score = 5.52457 sequence = CCAATGAAACGATTCAAATA Gene: Achl_3108: L-rhamnose mutarotase |
*
Arthrobacter sp. FB24 Site: position = -57 score = 5.46497 sequence = ACTTTGAATCGTAACAATGA Site: position = -44 score = 5.80469 sequence = ACAATGAAACGATTCAAAGA Gene: Arth_3307: L-rhamnose mutarotase |
|
|
|
|
|
|
|
|
|
|
|
L-rhamnose mutarotase |
| rhaI |
Gene: AAur_3715: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
Gene: Achl_3107: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
Gene: Arth_3306: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
*
Beutenbergia cavernae DSM 12333 Site: position = -63 score = 5.27968 sequence = GCTATGAATCGATTCAACCT Gene: Bcav_3624: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
*
Brachybacterium faecium DSM 4810 Site: position = -183 score = 4.62042 sequence = ATCCTGAGACGTTTCAAGAA Site: position = -119 score = 5.03797 sequence = GTGTTGAGTCGTTTCAAACA Gene: Bfae_29630: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
|
|
|
|
|
|
|
|
|
Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) |
| rhaEW |
Gene: AAur_3716: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: Achl_3106: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: Arth_3305: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: Bcav_3625: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: Bfae_29640: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
|
|
|
|
|
|
|
|
|
Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) |
| rhaB |
Gene: AAur_3717: Rhamnulokinase (EC 2.7.1.5) |
Gene: Achl_3105: Rhamnulokinase (EC 2.7.1.5) |
Gene: Arth_3304: Rhamnulokinase (EC 2.7.1.5) |
Gene: Bcav_3626: Rhamnulokinase (EC 2.7.1.5) |
Gene: Bfae_29650: Rhamnulokinase (EC 2.7.1.5) |
|
|
|
|
|
|
|
|
|
Rhamnulokinase (EC 2.7.1.5) |
| CRON 7. | |||||||||||||||
| rhaR |
*
Arthrobacter aurescens TC1 Site: position = -103 score = 5.52457 sequence = TCTTTGAATCGTTTCATTTG Site: position = -89 score = 5.16913 sequence = CATTTGTTACGATTCAAATT Gene: AAur_3713: Transcriptional regulator of rhamnose utilization, LacI family |
*
Arthrobacter chlorophenolicus A6 Site: position = -126 score = 5.52457 sequence = TATTTGAATCGTTTCATTGG Site: position = -113 score = 5.26867 sequence = TCATTGGTACGATTCAAAGT Gene: Achl_3109: Transcriptional regulator of rhamnose utilization, LacI family |
*
Arthrobacter sp. FB24 Site: position = -203 score = 5.80469 sequence = TCTTTGAATCGTTTCATTGT Site: position = -190 score = 5.46497 sequence = TCATTGTTACGATTCAAAGT Gene: Arth_3308: Transcriptional regulator of rhamnose utilization, LacI family |
Gene: Bcav_3608: Transcriptional regulator of rhamnose utilization, LacI family |
*
Brachybacterium faecium DSM 4810 Site: position = -150 score = 4.62958 sequence = GGTGTGAAACGACTCAAGCT Gene: Bfae_29660: Transcriptional regulator of rhamnose utilization, LacI family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator of rhamnose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |