Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing AAur_3305 gene

Properties
Regulog: RhaR - Micrococcineae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Phylum: Actinobacteria
Built upon 29 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -91
Score: 4.9468
Sequence: ATATTGTATCGATTCAGAAC
Locus tag: AAur_3309
Name: rhiN
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: AAur_3308
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: AAur_3307
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: AAur_3306
Name: AAur_3306
Funciton: hypothetical protein
Locus tag: AAur_3305
Name: AAur_3305
Funciton: putative transmembrane efflux protein (MFS)
rhiN-rhiF-rhiG-AAur_3306-AAur_3305 -91 4.9 ATATTGTATCGATTCAGAAC AAur_3309
Arthrobacter chlorophenolicus A6
Position: -92
Score: 4.91745
Sequence: ATATTGTATCGTTTCAGAAG
Locus tag: Achl_3124
Name: rhiN
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: Achl_3123
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: Achl_3122
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: Achl_3121
Name: AAur_3306
Funciton: hypothetical protein
Locus tag: Achl_3120
Name: AAur_3305
Funciton: putative transmembrane efflux protein (MFS)
rhiN-rhiF-rhiG-AAur_3306-AAur_3305 -92 4.9 ATATTGTATCGTTTCAGAAG Achl_3124
Arthrobacter sp. FB24
Position: -100
Score: 5.06509
Sequence: ATATTGTATCGTTTCAGAAA
Locus tag: Arth_3324
Name: rhiN
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: Arth_3323
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: Arth_3322
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: Arth_3321
Name: AAur_3306
Funciton: hypothetical protein
Locus tag: Arth_3320
Name: AAur_3305
Funciton: putative transmembrane efflux protein (MFS)
rhiN-rhiF-rhiG-AAur_3306-AAur_3305 -100 5.1 ATATTGTATCGTTTCAGAAA Arth_3324