Regulon of RhaR in Arthrobacter aurescens TC1

Properties
Regulator type:	Transcription factor
TF locus tag:	AAur_3713
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Regulog:	RhaR - Micrococcineae
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Rhamnose
By pathway - Rhamnose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5.2 Sequence: AATTTGAATCGTAACAAATG Position: -43 Score: 5.5 Sequence: CAAATGAAACGATTCAAAGA Locus tag: AAur_3714 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: AAur_3715 Name: rhaI Funciton: Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14) Locus tag: AAur_3716 Name: rhaEW Funciton: Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22) Locus tag: AAur_3717 Name: rhaB Funciton: Rhamnulokinase (EC 2.7.1.5)
	AAur_3714	rhaM	L-rhamnose mutarotase
	AAur_3715	rhaI	Predicted L-rhamnose isomerase RhaI (EC 5.3.1.14)
	AAur_3716	rhaEW	Predicted rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Predicted lactaldehyde dehydrogenase (EC 1.2.1.22)
	AAur_3717	rhaB	Rhamnulokinase (EC 2.7.1.5)
Position: -103 Score: 5.5 Sequence: TCTTTGAATCGTTTCATTTG Position: -89 Score: 5.2 Sequence: CATTTGTTACGATTCAAATT Locus tag: AAur_3713 Name: rhaR Funciton: Transcriptional regulator of rhamnose utilization, LacI family
	AAur_3713	rhaR	Transcriptional regulator of rhamnose utilization, LacI family
Position: -160 Score: 5.1 Sequence: GGTTTGAATCGTTACATTTT Locus tag: AAur_3304 Name: AAur_3304 Funciton: oxidoreductase domain protein
	AAur_3304	AAur_3304	oxidoreductase domain protein
Position: -91 Score: 4.9 Sequence: ATATTGTATCGATTCAGAAC Locus tag: AAur_3309 Name: rhiN Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: AAur_3308 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: AAur_3307 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: AAur_3306 Name: AAur_3306 Funciton: hypothetical protein Locus tag: AAur_3305 Name: AAur_3305 Funciton: putative transmembrane efflux protein (MFS)
	AAur_3309	rhiN	Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
	AAur_3308	rhiF	Putatuve rhamnogalacturonides ABC transporter, permease component 1
	AAur_3307	rhiG	Putatuve rhamnogalacturonides ABC transporter, permease component 2
	AAur_3306	AAur_3306	hypothetical protein
	AAur_3305	AAur_3305	putative transmembrane efflux protein (MFS)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD