Regulog SCO2753 - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | New effector |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By effector - New effector
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 4 | 2 |
| Streptomyces coelicolor A3(2) | 5 | 3 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 5 | 3 |
| Streptomyces scabiei 87.22 | 4 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| SCO2753 |
*
Streptomyces avermitilis MA-4680 Site: position = -182 score = 6.59482 sequence = CGCAGCAAGCGCTTTCTATG Gene: SAV_5312: Sugar utilization transctriptional regulator, LacI family |
*
Streptomyces coelicolor A3(2) Site: position = -163 score = 6.52863 sequence = TACAGCAAGCGCTTTCTATG Gene: SCO2753: Sugar utilization transctriptional regulator, LacI family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -90 score = 6.53179 sequence = CGTAGCAAGCGCTTTCTATC Gene: SGR_4812: Sugar utilization transctriptional regulator, LacI family |
*
Streptomyces scabiei 87.22 Site: position = -163 score = 6.6257 sequence = CACAGCAAGCGCTTTCTATC Gene: SCAB_58371: Sugar utilization transctriptional regulator, LacI family |
Sugar utilization transctriptional regulator, LacI family |
| CRON 2. | |||||
| SCO2752 |
*
Streptomyces avermitilis MA-4680 Site: position = -72 score = 6.59482 sequence = CATAGAAAGCGCTTGCTGCG Gene: SAV_5313: Predicted glucose-fructose oxidoreductase |
*
Streptomyces coelicolor A3(2) Site: position = -87 score = 6.52863 sequence = CATAGAAAGCGCTTGCTGTA Gene: SCO2752: Predicted glucose-fructose oxidoreductase |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -39 score = 6.53179 sequence = GATAGAAAGCGCTTGCTACG Gene: SGR_4813: Predicted glucose-fructose oxidoreductase |
*
Streptomyces scabiei 87.22 Site: position = -98 score = 6.6257 sequence = GATAGAAAGCGCTTGCTGTG Gene: SCAB_58381: Predicted glucose-fructose oxidoreductase |
Predicted glucose-fructose oxidoreductase |
| SCO2751 |
Gene: SAV_5314: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: SCO2751: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: SGR_4814: Conserved hypothetical protein, potentially related to sugar utilization |
Gene: SCAB_58391: Conserved hypothetical protein, potentially related to sugar utilization |
Conserved hypothetical protein, potentially related to sugar utilization |
| SCO2750 |
Gene: SAV_5315: Predicted sugar phosphate isomerases/epimerase |
Gene: SCO2750: Predicted sugar phosphate isomerases/epimerase |
Gene: SGR_4815: Predicted sugar phosphate isomerases/epimerase |
Gene: SCAB_58401: Predicted sugar phosphate isomerases/epimerase |
Predicted sugar phosphate isomerases/epimerase |
| CRON 3. | |||||
| pel |
|
*
Streptomyces coelicolor A3(2) Site: position = -89 score = 4.9414 sequence = CCGAGAAAGCGCTTTCCGCC Gene: SCO2821: putative secreted pectate lyase |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -216 score = 6.20379 sequence = TGTAGAAAGCGCTTGCTGTC Gene: SGR_217: putative secreted pectate lyase |
|
putative secreted pectate lyase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |