Regulon of SCO2753 in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO2753
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:	New effector
Regulog:	SCO2753 - Streptomycetaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - New effector
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.5 Sequence: CATAGAAAGCGCTTGCTGTA Locus tag: SCO2752 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: SCO2751 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: SCO2750 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	SCO2752	SCO2752	Predicted glucose-fructose oxidoreductase
	SCO2751	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	SCO2750	SCO2750	Predicted sugar phosphate isomerases/epimerase
Position: -163 Score: 6.5 Sequence: TACAGCAAGCGCTTTCTATG Locus tag: SCO2753 Name: SCO2753 Funciton: Sugar utilization transctriptional regulator, LacI family
	SCO2753	SCO2753	Sugar utilization transctriptional regulator, LacI family
Position: -89 Score: 4.9 Sequence: CCGAGAAAGCGCTTTCCGCC Locus tag: SCO2821 Name: pel Funciton: putative secreted pectate lyase
	SCO2821	pel	putative secreted pectate lyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD