Regulon of SCO2753 in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_4812
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:	New effector
Regulog:	SCO2753 - Streptomycetaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - New effector
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -216 Score: 6.2 Sequence: TGTAGAAAGCGCTTGCTGTC Locus tag: SGR_217 Name: pel Funciton: putative secreted pectate lyase
	SGR_217	pel	putative secreted pectate lyase
Position: -39 Score: 6.5 Sequence: GATAGAAAGCGCTTGCTACG Locus tag: SGR_4813 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: SGR_4814 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: SGR_4815 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	SGR_4813	SCO2752	Predicted glucose-fructose oxidoreductase
	SGR_4814	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	SGR_4815	SCO2750	Predicted sugar phosphate isomerases/epimerase
Position: -90 Score: 6.5 Sequence: CGTAGCAAGCGCTTTCTATC Locus tag: SGR_4812 Name: SCO2753 Funciton: Sugar utilization transctriptional regulator, LacI family
	SGR_4812	SCO2753	Sugar utilization transctriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD