Regulon of SCO2753 in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_58371
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:	New effector
Regulog:	SCO2753 - Streptomycetaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - New effector
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 6.6 Sequence: CACAGCAAGCGCTTTCTATC Locus tag: SCAB_58371 Name: SCO2753 Funciton: Sugar utilization transctriptional regulator, LacI family
	SCAB_58371	SCO2753	Sugar utilization transctriptional regulator, LacI family
Position: -98 Score: 6.6 Sequence: GATAGAAAGCGCTTGCTGTG Locus tag: SCAB_58381 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: SCAB_58391 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: SCAB_58401 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	SCAB_58381	SCO2752	Predicted glucose-fructose oxidoreductase
	SCAB_58391	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	SCAB_58401	SCO2750	Predicted sugar phosphate isomerases/epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD