Regulog RhaR - Streptomycetaceae

Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By effector - Rhamnose
- By pathway - Rhamnose utilization
Genome | Genes | Operons |
---|---|---|
Streptomyces avermitilis MA-4680 | 18 | 4 |
Streptomyces coelicolor A3(2) | 20 | 6 |
Streptomyces griseus subsp. griseus NBRC 13350 | ||
Streptomyces scabiei 87.22 | 19 | 4 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
rhaI |
*
Streptomyces avermitilis MA-4680 Site: position = -56 score = 5.8925 sequence = CTCCTGAATCGTTTCATACG Gene: SAV_7415: L-rhamnose isomerase (EC 5.3.1.14) |
*
Streptomyces coelicolor A3(2) Site: position = -68 score = 6.0716 sequence = GTTCTGAATCGTTTCACACA Gene: SCO0812: L-rhamnose isomerase (EC 5.3.1.14) |
|
*
Streptomyces scabiei 87.22 Site: position = -43 score = 6.24182 sequence = TTGCTGAATCGTTTCAGACA Gene: SCAB_9441: L-rhamnose isomerase (EC 5.3.1.14) |
L-rhamnose isomerase (EC 5.3.1.14) |
rhaEW |
Gene: SAV_7414: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22) |
Gene: SCO0813: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22) |
|
Gene: SCAB_9451: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22) |
Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22) |
rhaB |
Gene: SAV_7413: Rhamnulokinase (EC 2.7.1.5) |
Gene: SCO0814: Rhamnulokinase (EC 2.7.1.5) |
|
Gene: SCAB_9461: Rhamnulokinase (EC 2.7.1.5) |
Rhamnulokinase (EC 2.7.1.5) |
lldE |
Gene: SAV_7412: L-lactate dehydrogenase, Fe-S oxidoreductase subunit |
Gene: SCO0815: L-lactate dehydrogenase, Fe-S oxidoreductase subunit |
Gene: SGR_795: L-lactate dehydrogenase, Fe-S oxidoreductase subunit |
Gene: SCAB_9471: L-lactate dehydrogenase, Fe-S oxidoreductase subunit |
L-lactate dehydrogenase, Fe-S oxidoreductase subunit |
lldF |
Gene: SAV_7411: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit |
Gene: SCO0816: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit |
Gene: SGR_796: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit |
Gene: SCAB_9481: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit |
L-lactate dehydrogenase, iron-sulfur cluster-binding subunit |
lldG |
Gene: SAV_7410: L-lactate dehydrogenase, hypothetical subunit |
Gene: SCO0817: L-lactate dehydrogenase, hypothetical subunit |
Gene: SGR_797: L-lactate dehydrogenase, hypothetical subunit |
Gene: SCAB_9491: L-lactate dehydrogenase, hypothetical subunit |
L-lactate dehydrogenase, hypothetical subunit |
CRON 2. | |||||
rhaG |
*
Streptomyces avermitilis MA-4680 Site: position = -225 score = 5.8925 sequence = CGTATGAAACGATTCAGGAG Gene: SAV_7416: L-rhamnose ABC transporter, duplicated ATP-binding component |
*
Streptomyces coelicolor A3(2) Site: position = -228 score = 6.0716 sequence = TGTGTGAAACGATTCAGAAC Gene: SCO0811: L-rhamnose ABC transporter, duplicated ATP-binding component |
|
*
Streptomyces scabiei 87.22 Site: position = -235 score = 6.24182 sequence = TGTCTGAAACGATTCAGCAA Gene: SCAB_9431: L-rhamnose ABC transporter, duplicated ATP-binding component |
L-rhamnose ABC transporter, duplicated ATP-binding component |
rhaH |
Gene: SAV_7417: L-rhamnose ABC transporter, permease component 1 |
Gene: SCO0810: L-rhamnose ABC transporter, permease component 1 |
|
Gene: SCAB_9421: L-rhamnose ABC transporter, permease component 1 |
L-rhamnose ABC transporter, permease component 1 |
rhaJ |
Gene: SAV_7418: L-rhamnose ABC transporter, permease component 2 |
Gene: SCO0809: L-rhamnose ABC transporter, permease component 2 |
|
Gene: SCAB_9411: L-rhamnose ABC transporter, permease component 2 |
L-rhamnose ABC transporter, permease component 2 |
rhaF |
Gene: SAV_7419: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein |
Gene: SCO0808: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein |
|
Gene: SCAB_9401: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein |
L-rhamnose ABC transporter, periplasmic rhamnose-binding protein |
rhaM |
Gene: SAV_7420: L-rhamnose mutarotase |
Gene: SCO0807: L-rhamnose mutarotase |
|
Gene: SCAB_9391: L-rhamnose mutarotase |
L-rhamnose mutarotase |
rhaX |
Gene: SAV_7421: Putative rhamnoside hydrolase |
|
|
Gene: SCAB_9381: Putative rhamnoside hydrolase |
Putative rhamnoside hydrolase |
rhaR |
Gene: SAV_7422: Rhamnose utilization transcriptional regulator RhaR, LacI family |
Gene: SCO0806: Rhamnose utilization transcriptional regulator RhaR, LacI family |
|
Gene: SCAB_9371: Rhamnose utilization transcriptional regulator RhaR, LacI family |
Rhamnose utilization transcriptional regulator RhaR, LacI family |
CRON 3. | |||||
rhmA3 |
|
*
Streptomyces coelicolor A3(2) Site: position = 22 score = 4.89092 sequence = CGGTTGAAACGTTTCAAGCG Gene: SCO0488: putative rhamnosidase |
|
|
putative rhamnosidase |
CRON 4. | |||||
SCF41.30c |
|
*
Streptomyces coelicolor A3(2) Site: position = -41 score = 4.03855 sequence = CGAGTAAAACGATTCAATCG Gene: SCO0371: COG3533 secreted protein |
|
|
COG3533 secreted protein |
SCF41.29c |
|
Gene: SCO0370: Predicted alpha-L-rhamnosidase |
|
|
Predicted alpha-L-rhamnosidase |
SCF41.28c |
|
Gene: SCO0369: putative secreted protein |
|
*
Streptomyces scabiei 87.22 Site: position = -54 score = 4.11198 sequence = GTGATGAAACGTTTTAATCC Gene: SCAB_86701: putative secreted protein |
putative secreted protein |
SCAB_86711 |
|
|
|
Gene: SCAB_86711: putative exported rhamnosidase A |
putative exported rhamnosidase A |
CRON 5. | |||||
rhmA2 |
|
*
Streptomyces coelicolor A3(2) Site: position = -53 score = 4.28657 sequence = GGATTGAATCGATTCAATCA Gene: SCO0372: Predicted alpha-L-rhamnosidase |
|
Gene: SCAB_77201: Predicted alpha-L-rhamnosidase |
Predicted alpha-L-rhamnosidase |
CRON 6. | |||||
rhmA |
*
Streptomyces avermitilis MA-4680 Site: position = -155 score = 4.27671 sequence = GCTGTGAATCGATTCACCTT Gene: SAV_828: rhamnosidase |
|
|
|
rhamnosidase |
CRON 7. | |||||
rhiL |
*
Streptomyces avermitilis MA-4680 Site: position = -52 score = 4.68169 sequence = TACTTGAAACGATTCATGAC Gene: SAV_6812: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
*
Streptomyces coelicolor A3(2) Site: position = -48 score = 4.78631 sequence = TACTTGAAACGATTCATGAG Gene: SCO1539: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
|
*
Streptomyces scabiei 87.22 Site: position = -50 score = 4.2288 sequence = TACTTGAAACGATTCACGGC Gene: SCAB_74641: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
rhiF |
Gene: SAV_6813: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
Gene: SCO1538: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
|
Gene: SCAB_74651: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
rhiG |
Gene: SAV_6814: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
Gene: SCO1537: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
|
Gene: SCAB_74661: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
SAV_6815 |
Gene: SAV_6815: hypothetical protein |
|
|
Gene: SCAB_74671: hypothetical protein |
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |