Regulog RhaR - Streptomycetaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Rhamnose
By pathway - Rhamnose utilization

Statistics of regulated genes
Genome	Genes	Operons
Streptomyces avermitilis MA-4680	18	4
Streptomyces coelicolor A3(2)	20	6
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22	19	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
rhaI	* Streptomyces avermitilis MA-4680 Site: position = -56 score = 5.8925 sequence = CTCCTGAATCGTTTCATACG Gene: SAV_7415: L-rhamnose isomerase (EC 5.3.1.14)	* Streptomyces coelicolor A3(2) Site: position = -68 score = 6.0716 sequence = GTTCTGAATCGTTTCACACA Gene: SCO0812: L-rhamnose isomerase (EC 5.3.1.14)	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -43 score = 6.24182 sequence = TTGCTGAATCGTTTCAGACA Gene: SCAB_9441: L-rhamnose isomerase (EC 5.3.1.14)	L-rhamnose isomerase (EC 5.3.1.14)
rhaEW	Streptomyces avermitilis MA-4680 Gene: SAV_7414: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)	Streptomyces coelicolor A3(2) Gene: SCO0813: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9451: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)	Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
rhaB	Streptomyces avermitilis MA-4680 Gene: SAV_7413: Rhamnulokinase (EC 2.7.1.5)	Streptomyces coelicolor A3(2) Gene: SCO0814: Rhamnulokinase (EC 2.7.1.5)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9461: Rhamnulokinase (EC 2.7.1.5)	Rhamnulokinase (EC 2.7.1.5)
lldE	Streptomyces avermitilis MA-4680 Gene: SAV_7412: L-lactate dehydrogenase, Fe-S oxidoreductase subunit	Streptomyces coelicolor A3(2) Gene: SCO0815: L-lactate dehydrogenase, Fe-S oxidoreductase subunit	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_795: L-lactate dehydrogenase, Fe-S oxidoreductase subunit	Streptomyces scabiei 87.22 Gene: SCAB_9471: L-lactate dehydrogenase, Fe-S oxidoreductase subunit	L-lactate dehydrogenase, Fe-S oxidoreductase subunit
lldF	Streptomyces avermitilis MA-4680 Gene: SAV_7411: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit	Streptomyces coelicolor A3(2) Gene: SCO0816: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_796: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit	Streptomyces scabiei 87.22 Gene: SCAB_9481: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit	L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
lldG	Streptomyces avermitilis MA-4680 Gene: SAV_7410: L-lactate dehydrogenase, hypothetical subunit	Streptomyces coelicolor A3(2) Gene: SCO0817: L-lactate dehydrogenase, hypothetical subunit	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_797: L-lactate dehydrogenase, hypothetical subunit	Streptomyces scabiei 87.22 Gene: SCAB_9491: L-lactate dehydrogenase, hypothetical subunit	L-lactate dehydrogenase, hypothetical subunit

CRON 2.
rhaG	* Streptomyces avermitilis MA-4680 Site: position = -225 score = 5.8925 sequence = CGTATGAAACGATTCAGGAG Gene: SAV_7416: L-rhamnose ABC transporter, duplicated ATP-binding component	* Streptomyces coelicolor A3(2) Site: position = -228 score = 6.0716 sequence = TGTGTGAAACGATTCAGAAC Gene: SCO0811: L-rhamnose ABC transporter, duplicated ATP-binding component	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -235 score = 6.24182 sequence = TGTCTGAAACGATTCAGCAA Gene: SCAB_9431: L-rhamnose ABC transporter, duplicated ATP-binding component	L-rhamnose ABC transporter, duplicated ATP-binding component
rhaH	Streptomyces avermitilis MA-4680 Gene: SAV_7417: L-rhamnose ABC transporter, permease component 1	Streptomyces coelicolor A3(2) Gene: SCO0810: L-rhamnose ABC transporter, permease component 1	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9421: L-rhamnose ABC transporter, permease component 1	L-rhamnose ABC transporter, permease component 1
rhaJ	Streptomyces avermitilis MA-4680 Gene: SAV_7418: L-rhamnose ABC transporter, permease component 2	Streptomyces coelicolor A3(2) Gene: SCO0809: L-rhamnose ABC transporter, permease component 2	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9411: L-rhamnose ABC transporter, permease component 2	L-rhamnose ABC transporter, permease component 2
rhaF	Streptomyces avermitilis MA-4680 Gene: SAV_7419: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein	Streptomyces coelicolor A3(2) Gene: SCO0808: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9401: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein	L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
rhaM	Streptomyces avermitilis MA-4680 Gene: SAV_7420: L-rhamnose mutarotase	Streptomyces coelicolor A3(2) Gene: SCO0807: L-rhamnose mutarotase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9391: L-rhamnose mutarotase	L-rhamnose mutarotase
rhaX	Streptomyces avermitilis MA-4680 Gene: SAV_7421: Putative rhamnoside hydrolase	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9381: Putative rhamnoside hydrolase	Putative rhamnoside hydrolase
rhaR	Streptomyces avermitilis MA-4680 Gene: SAV_7422: Rhamnose utilization transcriptional regulator RhaR, LacI family	Streptomyces coelicolor A3(2) Gene: SCO0806: Rhamnose utilization transcriptional regulator RhaR, LacI family	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_9371: Rhamnose utilization transcriptional regulator RhaR, LacI family	Rhamnose utilization transcriptional regulator RhaR, LacI family

CRON 3.
rhmA3	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = 22 score = 4.89092 sequence = CGGTTGAAACGTTTCAAGCG Gene: SCO0488: putative rhamnosidase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	putative rhamnosidase

CRON 4.
SCF41.30c	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -41 score = 4.03855 sequence = CGAGTAAAACGATTCAATCG Gene: SCO0371: COG3533 secreted protein	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	COG3533 secreted protein
SCF41.29c	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2) Gene: SCO0370: Predicted alpha-L-rhamnosidase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Predicted alpha-L-rhamnosidase
SCF41.28c	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2) Gene: SCO0369: putative secreted protein	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -54 score = 4.11198 sequence = GTGATGAAACGTTTTAATCC Gene: SCAB_86701: putative secreted protein	putative secreted protein
SCAB_86711	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_86711: putative exported rhamnosidase A	putative exported rhamnosidase A

CRON 5.
rhmA2	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -53 score = 4.28657 sequence = GGATTGAATCGATTCAATCA Gene: SCO0372: Predicted alpha-L-rhamnosidase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_77201: Predicted alpha-L-rhamnosidase	Predicted alpha-L-rhamnosidase

CRON 6.
rhmA	* Streptomyces avermitilis MA-4680 Site: position = -155 score = 4.27671 sequence = GCTGTGAATCGATTCACCTT Gene: SAV_828: rhamnosidase	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	rhamnosidase

CRON 7.
rhiL	* Streptomyces avermitilis MA-4680 Site: position = -52 score = 4.68169 sequence = TACTTGAAACGATTCATGAC Gene: SAV_6812: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein	* Streptomyces coelicolor A3(2) Site: position = -48 score = 4.78631 sequence = TACTTGAAACGATTCATGAG Gene: SCO1539: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces scabiei 87.22 Site: position = -50 score = 4.2288 sequence = TACTTGAAACGATTCACGGC Gene: SCAB_74641: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein	Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
rhiF	Streptomyces avermitilis MA-4680 Gene: SAV_6813: Putatuve rhamnogalacturonides ABC transporter, permease component 1	Streptomyces coelicolor A3(2) Gene: SCO1538: Putatuve rhamnogalacturonides ABC transporter, permease component 1	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_74651: Putatuve rhamnogalacturonides ABC transporter, permease component 1	Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiG	Streptomyces avermitilis MA-4680 Gene: SAV_6814: Putatuve rhamnogalacturonides ABC transporter, permease component 2	Streptomyces coelicolor A3(2) Gene: SCO1537: Putatuve rhamnogalacturonides ABC transporter, permease component 2	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_74661: Putatuve rhamnogalacturonides ABC transporter, permease component 2	Putatuve rhamnogalacturonides ABC transporter, permease component 2
SAV_6815	Streptomyces avermitilis MA-4680 Gene: SAV_6815: hypothetical protein	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_74671: hypothetical protein	hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RhaR - Streptomycetaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --