Orthologous regulated operons containing rhaG gene

Properties
Regulog:	RhaR - Streptomycetaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -225 Score: 5.8925 Sequence: CGTATGAAACGATTCAGGAG Locus tag: SAV_7416 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: SAV_7417 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: SAV_7418 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: SAV_7419 Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein Locus tag: SAV_7420 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: SAV_7421 Name: rhaX Funciton: Putative rhamnoside hydrolase Locus tag: SAV_7422 Name: rhaR Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG-rhaH-rhaJ-rhaF-rhaM-rhaX-rhaR	-225	5.9	CGTATGAAACGATTCAGGAG	SAV_7416
Streptomyces coelicolor A3(2)
Position: -228 Score: 6.0716 Sequence: TGTGTGAAACGATTCAGAAC Locus tag: SCO0811 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: SCO0810 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: SCO0809 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: SCO0808 Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein Locus tag: SCO0807 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: SCO0806 Name: rhaR Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG-rhaH-rhaJ-rhaF-rhaM-rhaR	-228	6.1	TGTGTGAAACGATTCAGAAC	SCO0811
Streptomyces scabiei 87.22
Position: -235 Score: 6.24182 Sequence: TGTCTGAAACGATTCAGCAA Locus tag: SCAB_9431 Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component Locus tag: SCAB_9421 Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1 Locus tag: SCAB_9411 Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2 Locus tag: SCAB_9401 Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein Locus tag: SCAB_9391 Name: rhaM Funciton: L-rhamnose mutarotase Locus tag: SCAB_9381 Name: rhaX Funciton: Putative rhamnoside hydrolase Locus tag: SCAB_9371 Name: rhaR Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG-rhaH-rhaJ-rhaF-rhaM-rhaX-rhaR	-235	6.2	TGTCTGAAACGATTCAGCAA	SCAB_9431