Regulog ManR - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By effector - Mannose
- By pathway - Mannosides utilization
- By pathway - Mannose utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 4 | 4 |
| Streptomyces coelicolor A3(2) | 6 | 5 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 3 | 3 |
| Streptomyces scabiei 87.22 | 3 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| manA |
*
Streptomyces avermitilis MA-4680 Site: position = -51 score = 5.65262 sequence = AGTTGACAACGTTGTCCATT Gene: SAV_2252: Alpha-1,2-mannosidase |
*
Streptomyces coelicolor A3(2) Site: position = -42 score = 5.93695 sequence = ATTTGACAACGTTGTCCCAC Gene: SCO6004: Alpha-1,2-mannosidase |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -47 score = 6.19416 sequence = CTATGACAACGTTGTCCAGG Gene: SGR_1503: Alpha-1,2-mannosidase |
Gene: SCAB_21071: Alpha-1,2-mannosidase |
Alpha-1,2-mannosidase |
| CRON 2. | |||||
| SCO6428 |
|
*
Streptomyces coelicolor A3(2) Site: position = -41 score = 6.35152 sequence = GCTTGACAACGTTGTCCACC Gene: SCO6428: putative secreted protein |
|
|
putative secreted protein |
| CRON 3. | |||||
| manA2 |
|
*
Streptomyces coelicolor A3(2) Site: position = -49 score = 6.09278 sequence = GCGGGACAACGTTGTCAGGT Gene: SCO6234: secreted beta-mannosidase |
|
Gene: SCAB_82021: secreted beta-mannosidase |
secreted beta-mannosidase |
| CRON 4. | |||||
| manA3 |
*
Streptomyces avermitilis MA-4680 Site: position = -164 score = 4.82656 sequence = AACCGACAACGATGTCAAGC Site: position = -210 score = 5.10664 sequence = CGGCGACAACGTTGTCTGAG Gene: SAV_2253: Alpha-1,2-mannosidase |
|
|
|
Alpha-1,2-mannosidase |
| CRON 5. | |||||
| manR |
*
Streptomyces avermitilis MA-4680 Site: position = -99 score = 6.415 sequence = GTCTGACAACGTTGTCCAGG Gene: SAV_1477: Predicted mannoside utilization transcriptional regulator, LacI family |
*
Streptomyces coelicolor A3(2) Site: position = -125 score = 6.31209 sequence = ATCTGACAACGTTGTCCAGG Gene: SCO1078: Predicted mannoside utilization transcriptional regulator, LacI family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -133 score = 6.36501 sequence = TGTTGACAACGTTGTCCAGG Gene: SGR_6529: Predicted mannoside utilization transcriptional regulator, LacI family |
*
Streptomyces scabiei 87.22 Site: position = -112 score = 6.46792 sequence = GCGTGACAACGTTGTCCAGG Gene: SCAB_82731: Predicted mannoside utilization transcriptional regulator, LacI family |
Predicted mannoside utilization transcriptional regulator, LacI family |
| SCO1079 |
|
Gene: SCO1079: Conserved hypothetical protein |
|
Gene: SCAB_82721: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 6. | |||||
| manK |
*
Streptomyces avermitilis MA-4680 Site: position = -172 score = 6.415 sequence = CCTGGACAACGTTGTCAGAC Gene: SAV_1476: Predicted mannokinase, ROK family |
*
Streptomyces coelicolor A3(2) Site: position = -135 score = 6.31209 sequence = CCTGGACAACGTTGTCAGAT Gene: SCO1077: Predicted mannokinase, ROK family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -93 score = 6.36501 sequence = CCTGGACAACGTTGTCAACA Gene: SGR_6530: Predicted mannokinase, ROK family |
*
Streptomyces scabiei 87.22 Site: position = -76 score = 6.46792 sequence = CCTGGACAACGTTGTCACGC Gene: SCAB_82741: Predicted mannokinase, ROK family |
Predicted mannokinase, ROK family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |