Statistics of regulated genes

Genome	Genes	Operons
Streptomyces avermitilis MA-4680	4	4
Streptomyces coelicolor A3(2)	6	5
Streptomyces griseus subsp. griseus NBRC 13350	3	3
Streptomyces scabiei 87.22	3	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
manA	* Streptomyces avermitilis MA-4680 Site: position = -51 score = 5.65262 sequence = AGTTGACAACGTTGTCCATT Gene: SAV_2252: Alpha-1,2-mannosidase	* Streptomyces coelicolor A3(2) Site: position = -42 score = 5.93695 sequence = ATTTGACAACGTTGTCCCAC Gene: SCO6004: Alpha-1,2-mannosidase	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -47 score = 6.19416 sequence = CTATGACAACGTTGTCCAGG Gene: SGR_1503: Alpha-1,2-mannosidase	Streptomyces scabiei 87.22 Gene: SCAB_21071: Alpha-1,2-mannosidase	Alpha-1,2-mannosidase
CRON 2.
SCO6428	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -41 score = 6.35152 sequence = GCTTGACAACGTTGTCCACC Gene: SCO6428: putative secreted protein	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	putative secreted protein
CRON 3.
manA2	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -49 score = 6.09278 sequence = GCGGGACAACGTTGTCAGGT Gene: SCO6234: secreted beta-mannosidase	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_82021: secreted beta-mannosidase	secreted beta-mannosidase
CRON 4.
manA3	* Streptomyces avermitilis MA-4680 Site: position = -164 score = 4.82656 sequence = AACCGACAACGATGTCAAGC Site: position = -210 score = 5.10664 sequence = CGGCGACAACGTTGTCTGAG Gene: SAV_2253: Alpha-1,2-mannosidase	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22	Alpha-1,2-mannosidase
CRON 5.
manR	* Streptomyces avermitilis MA-4680 Site: position = -99 score = 6.415 sequence = GTCTGACAACGTTGTCCAGG Gene: SAV_1477: Predicted mannoside utilization transcriptional regulator, LacI family	* Streptomyces coelicolor A3(2) Site: position = -125 score = 6.31209 sequence = ATCTGACAACGTTGTCCAGG Gene: SCO1078: Predicted mannoside utilization transcriptional regulator, LacI family	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -133 score = 6.36501 sequence = TGTTGACAACGTTGTCCAGG Gene: SGR_6529: Predicted mannoside utilization transcriptional regulator, LacI family	* Streptomyces scabiei 87.22 Site: position = -112 score = 6.46792 sequence = GCGTGACAACGTTGTCCAGG Gene: SCAB_82731: Predicted mannoside utilization transcriptional regulator, LacI family	Predicted mannoside utilization transcriptional regulator, LacI family
SCO1079	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2) Gene: SCO1079: Conserved hypothetical protein	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces scabiei 87.22 Gene: SCAB_82721: Conserved hypothetical protein	Conserved hypothetical protein
CRON 6.
manK	* Streptomyces avermitilis MA-4680 Site: position = -172 score = 6.415 sequence = CCTGGACAACGTTGTCAGAC Gene: SAV_1476: Predicted mannokinase, ROK family	* Streptomyces coelicolor A3(2) Site: position = -135 score = 6.31209 sequence = CCTGGACAACGTTGTCAGAT Gene: SCO1077: Predicted mannokinase, ROK family	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -93 score = 6.36501 sequence = CCTGGACAACGTTGTCAACA Gene: SGR_6530: Predicted mannokinase, ROK family	* Streptomyces scabiei 87.22 Site: position = -76 score = 6.46792 sequence = CCTGGACAACGTTGTCACGC Gene: SCAB_82741: Predicted mannokinase, ROK family	Predicted mannokinase, ROK family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD