Regulon of ManR in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_82731
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR - Streptomycetaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -112 Score: 6.5 Sequence: GCGTGACAACGTTGTCCAGG Locus tag: SCAB_82731 Name: manR Funciton: Predicted mannoside utilization transcriptional regulator, LacI family Locus tag: SCAB_82721 Name: SCO1079 Funciton: Conserved hypothetical protein
	SCAB_82731	manR	Predicted mannoside utilization transcriptional regulator, LacI family
	SCAB_82721	SCO1079	Conserved hypothetical protein
Position: -76 Score: 6.5 Sequence: CCTGGACAACGTTGTCACGC Locus tag: SCAB_82741 Name: manK Funciton: Predicted mannokinase, ROK family
	SCAB_82741	manK	Predicted mannokinase, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD