Regulon of ManR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_6529
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR - Streptomycetaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 6.4 Sequence: TGTTGACAACGTTGTCCAGG Locus tag: SGR_6529 Name: manR Funciton: Predicted mannoside utilization transcriptional regulator, LacI family
	SGR_6529	manR	Predicted mannoside utilization transcriptional regulator, LacI family
Position: -93 Score: 6.4 Sequence: CCTGGACAACGTTGTCAACA Locus tag: SGR_6530 Name: manK Funciton: Predicted mannokinase, ROK family
	SGR_6530	manK	Predicted mannokinase, ROK family
Position: -47 Score: 6.2 Sequence: CTATGACAACGTTGTCCAGG Locus tag: SGR_1503 Name: manA Funciton: Alpha-1,2-mannosidase
	SGR_1503	manA	Alpha-1,2-mannosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD