Regulon of ManR in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO1078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR - Streptomycetaceae
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -125 Score: 6.3 Sequence: ATCTGACAACGTTGTCCAGG Locus tag: SCO1078 Name: manR Funciton: Predicted mannoside utilization transcriptional regulator, LacI family Locus tag: SCO1079 Name: SCO1079 Funciton: Conserved hypothetical protein
	SCO1078	manR	Predicted mannoside utilization transcriptional regulator, LacI family
	SCO1079	SCO1079	Conserved hypothetical protein
Position: -135 Score: 6.3 Sequence: CCTGGACAACGTTGTCAGAT Locus tag: SCO1077 Name: manK Funciton: Predicted mannokinase, ROK family
	SCO1077	manK	Predicted mannokinase, ROK family
Position: -49 Score: 6.1 Sequence: GCGGGACAACGTTGTCAGGT Locus tag: SCO6234 Name: manA2 Funciton: secreted beta-mannosidase
	SCO6234	manA2	secreted beta-mannosidase
Position: -42 Score: 5.9 Sequence: ATTTGACAACGTTGTCCCAC Locus tag: SCO6004 Name: manA Funciton: Alpha-1,2-mannosidase
	SCO6004	manA	Alpha-1,2-mannosidase
Position: -41 Score: 6.4 Sequence: GCTTGACAACGTTGTCCACC Locus tag: SCO6428 Name: SCO6428 Funciton: putative secreted protein
	SCO6428	SCO6428	putative secreted protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD