Regulog TreR - Thermoanaerobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Statistics of regulated genes
Genome	Genes	Operons
Anaerocellum thermophilum DSM 6725
Caldicellulosiruptor saccharolyticus DSM 8903
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514	5	2
Thermoanaerobacter italicus Ab9	5	2
Thermoanaerobacter tengcongensis MB4	5	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
treF	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -74 score = 6.61324 sequence = AATTGTAAGCGCTTACAGTT Gene: Teth514_2196: Predicted trehalose utilization ABC transporter, permease protein 1	* Thermoanaerobacter italicus Ab9 Site: position = -77 score = 6.20408 sequence = GATTGTAAGCGCTTACAGTT Gene: Thit_0761: Predicted trehalose utilization ABC transporter, permease protein 1	* Thermoanaerobacter tengcongensis MB4 Site: position = -63 score = 6.08643 sequence = AACTGTAAGCGCTTTCAATA Gene: TTE0804: Predicted trehalose utilization ABC transporter, permease protein 1	Predicted trehalose utilization ABC transporter, permease protein 1
treG	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_2195: Predicted trehalose utilization ABC transporter, permease protein 2	Thermoanaerobacter italicus Ab9 Gene: Thit_0762: Predicted trehalose utilization ABC transporter, permease protein 2	Thermoanaerobacter tengcongensis MB4 Gene: TTE0805: Predicted trehalose utilization ABC transporter, permease protein 2	Predicted trehalose utilization ABC transporter, permease protein 2
treE	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_2194: Predicted trehalose utilization ABC transporter, substrate-binding protein	Thermoanaerobacter italicus Ab9 Gene: Thit_0763: Predicted trehalose utilization ABC transporter, substrate-binding protein	Thermoanaerobacter tengcongensis MB4 Gene: TTE0806: Predicted trehalose utilization ABC transporter, substrate-binding protein	Predicted trehalose utilization ABC transporter, substrate-binding protein
treP	Anaerocellum thermophilum DSM 6725 Gene: Athe_0403: Trehalose phosphorylase (EC 2.4.1.64)	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0444: Trehalose phosphorylase (EC 2.4.1.64)	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_2193: Trehalose phosphorylase (EC 2.4.1.64)	Thermoanaerobacter italicus Ab9 Gene: Thit_0764: Trehalose phosphorylase (EC 2.4.1.64)	Thermoanaerobacter tengcongensis MB4 Gene: TTE0807: Trehalose phosphorylase (EC 2.4.1.64)	Trehalose phosphorylase (EC 2.4.1.64)

CRON 2.
treR	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -41 score = 7.14005 sequence = AACTGTAAGCGGTTACAGTA Gene: Teth514_2197: Predicted trehalose utilization transcriptional regulator, LacI family	* Thermoanaerobacter italicus Ab9 Site: position = -41 score = 7.14005 sequence = AACTGTAAGCGGTTACAGTA Gene: Thit_0760: Predicted trehalose utilization transcriptional regulator, LacI family	* Thermoanaerobacter tengcongensis MB4 Site: position = -41 score = 7.14005 sequence = AACTGTAAGCGGTTACAGTA Gene: TTE0803: Predicted trehalose utilization transcriptional regulator, LacI family	Predicted trehalose utilization transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog TreR - Thermoanaerobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --