Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing treE gene

Properties
Regulog: TreR - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Firmicutes
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermoanaerobacter ethanolicus X514
Position: -74
Score: 6.61324
Sequence: AATTGTAAGCGCTTACAGTT
Locus tag: Teth514_2196
Name: treF
Funciton: Predicted trehalose utilization ABC transporter, permease protein 1
Locus tag: Teth514_2195
Name: treG
Funciton: Predicted trehalose utilization ABC transporter, permease protein 2
Locus tag: Teth514_2194
Name: treE
Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein
Locus tag: Teth514_2193
Name: treP
Funciton: Trehalose phosphorylase (EC 2.4.1.64)
treF-treG-treE-treP -74 6.6 AATTGTAAGCGCTTACAGTT Teth514_2196
Thermoanaerobacter italicus Ab9
Position: -77
Score: 6.20408
Sequence: GATTGTAAGCGCTTACAGTT
Locus tag: Thit_0761
Name: treF
Funciton: Predicted trehalose utilization ABC transporter, permease protein 1
Locus tag: Thit_0762
Name: treG
Funciton: Predicted trehalose utilization ABC transporter, permease protein 2
Locus tag: Thit_0763
Name: treE
Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein
Locus tag: Thit_0764
Name: treP
Funciton: Trehalose phosphorylase (EC 2.4.1.64)
treF-treG-treE-treP -77 6.2 GATTGTAAGCGCTTACAGTT Thit_0761
Thermoanaerobacter tengcongensis MB4
Position: -63
Score: 6.08643
Sequence: AACTGTAAGCGCTTTCAATA
Locus tag: TTE0804
Name: treF
Funciton: Predicted trehalose utilization ABC transporter, permease protein 1
Locus tag: TTE0805
Name: treG
Funciton: Predicted trehalose utilization ABC transporter, permease protein 2
Locus tag: TTE0806
Name: treE
Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein
Locus tag: TTE0807
Name: treP
Funciton: Trehalose phosphorylase (EC 2.4.1.64)
treF-treG-treE-treP -63 6.1 AACTGTAAGCGCTTTCAATA TTE0804